Description :
From Genome Similarity Track
Location :
Scaffold_241:927- 2693
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_241-snap-gene-0.9Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_241-fgenesh-gene-0.4Calcyclin binding protein

Sequence
1766 bases(100 bases per row)
ATGGACTCGCGCTGCATCAAGTTCTGGGAGGACGGTCAGGAGCTCATCAAGAGCGCGGCCGATGCGTCGCGGCTCGCGCACACGCTGGGCAAGATGCTCA
AGGAGCTGCGCATCATGTCGCGCTTCCTGCAGAAGAACCAGGCGTCGCGCTTCAGCGACAACGCGCAACAGAAGCTCGTGGACGCGGTCGCGGCCTACGT
GACCTTTAGCAAGCAGCGCGTGATGGTGCAGACGAGCGACGAGAGCGACCAGCAGCTCGTCGAGGCTGTCTTCGGGGTCGTCAAAGACGGACTCGCGATG
CCCTTCAACGTCATGGGCACCAAGCAGAAGAAGCGACTGATGAAGTGGTACAACGAGCTCATTGGCATCGTCCCCAATGCGCTCGCGGCGGACGACTCCG
GTGTCGCAGTACCCAAACCAGTGGAGTGGAGCGTGCTGGGCCTGGATGACGACGACGGGTACCTCTCGCTGATGGACGACGCCACTGGCGCCACATGTGA
GACCTTCCAGGTGAAGAAGAAGAGTAAGGAGTACAAGCAGATCCAGAAGGGACTCGAGAGTGCTGACGTCTTTGTCGTCACGCTCGGCGACGAGATCATC
GAGATCCGAGTCGTAGAGGAAGATGAATGACATGGAGAATTCCCATTCATAGATGTAAAGAATACTAAACCGTCTCGCGTTGGGCTTGTGGCCTAGAGCC
CAGCAGCTGCGTTCTTCTGTTGGCTTTCCGACCACGCCTTTGCGATCGTGCGCTTCATCTCTTCATCGCCCTCGTCATACATATTCTACAAGTACAAGAG
CATCCACACTAAGTTACTAGTGGCTCATAGAGAGAAGGTAATACGACACTAACAATGGCGCACCTTCATCATGTCCATGATCCCGGCGGACGGGTCGCTG
GTGTTGGGCTTGAGCGACTTGCCCGGGTTCTTCTCCGTCAAGTTCATCCACGAGTGGTTCTTGTCGGCCTTCCAGAGCGAGATCGTCACGCGGTTCTTCT
TCACGCGGAACGAGCTCTTGGACGGCACGATGTCCTTGTCCAGGTACGTCTTCACGAGTCTGTACATAATTCAGACAAGTACATTGTTTAGCGACACGCT
GCAGCATAACGACTCGTGCTTCATTGCTGCCCTTACCGATAGTTCTTCCCGTGAAGACCCAGAATCTGTCCATGCATTACAAGGGCAAGTTCATGTATTA
AAACCCTCAAGTGTGGATACAGGAAGGAATATCGTAGTGTGTACCTTGAGGTCGAACGATGATTTGGTGAACGTGCACGTCACGCTTTCCTTGGGCAAGT
CACCGACGCCGTCAATGCCGGACATGACGTACACCGAGACTTTGTCCTTTCCATAGCCTACACATATACAATGCACCACGTTAATACACACTTGATGATC
ATCCAAGATACTCATGCAATGATCATTCAGTTGGTTACCTTCGTCTTCCCAGCCAAAGCGCGAGATCTCCGTGTACACGTTCAGGTCATCCACCTCATTG
CTCTTGACCACGTGCACTGCAACAGGTTGCTTTGCGGCCACTGGTACTGCTGTGGCCACTGGCGCTTGCGCTTCTTCCGGAATGCTAGCAGACGCATCCT
CCATCGCCACATCCGCGGCATCGACTGCCGAGGCGACGAGCGCCTGCTGCTTCTCCGCCAGCAGACGCGTGAGGTCACGCACGTTGCCCGGCGCCTTGGC
TTGCGCCAGCAGCTGCTGCAGCTCGGCCACTTCGTCGCTCAGCGTGCTCTCGTCGCGTGCCATCGC