Description :
From Genome Similarity Track
Location :
Scaffold_819:9269- 10681
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_819-snap-gene-0.11RNA binding protein

Sequence
1412 bases(100 bases per row)
TAGGGACGGCAGGTCAGGCTCTTCTTGTGCGCGATCTTTCTTCGTAGCAGGTGTGGCTGTAGCCTTTTCTTGTCTACTGCGAGTGGCTGCTAGGTCGACC
AGGTGTGGTGCCAGCTCTGTCGAGAAAAGGTCTTGAGGCTTTTCATCATCGTCTCCTCCTGATATCGTACGTCCTTTGCATTTCACACGGAACCGCTTGC
ACAGAAGTGCTTGCGGAGCCCAAGCGTCTTCACTTCGATTTGACTTCTTCACCAGTGAGATCGAAGTCTGCCGATCTTCAGCTTTTGAGTCATTTGCTTC
AGTGAAAGAAGCCGAAACAAATCTCTtGgCGATGGACGCGGTGATATTGGCCCGAAACTGGTCACTGCTTGGACCCTGAATGAGTGGCTTCCGCTCAGCT
CGTGCCGCATGAGCCGCTTGTAAAAGCTTATCTCTTTGGGATGGATCAAGCAGGTCGAACACGCTTCCATGGGCCTTTTCATCGCGCGATAGAGAGGTCT
CATCCGAGTCCTGCAGTATCCTTGCCCGTTGCTGAGCAGTCATGATACTGCCTCGCCCGCCCTTCTCAGTTGTGAAGTTGAATTTGGAATAGACTGTCCG
cACACTATGACCATCGTCCTCCTTCTCAAACGaGTGATAGGCGCGGAAGTCTGATGGCACTTTGAGTCGTTGGATCACTTGCGTTGCTGGCTTCtCGCGT
AATCTCGCGATGTGGAAACCTGGTAGTGCAGGTCTCTCATCTGCACACAGCACTCCTGACGAGAGCTCAGCGTTACGTTGACGCTTCTCCTCACGCTCGC
GGCTGCTCATTAAATCGATTAGCTTGGTGGATTCTCCACTTGGCGCGATTGCTCGATCGAAGTCGTCCATGGATGTCGTGCCGTACACGTCCAGGTCGTC
ATTATCCTCGAGTGCGCTCAGTCCGAATGCCATTGCGGCACGACTGCTACTCGTGCTGCTTCCACCACCTAGAGCCTCGGCAAAGGTAACAATCTGGCGC
TGTGGTGGCTGGGACTTGTCGGTATTCTGCCTCATCTTGTGCTTCATGAACTCGGGAGCGTCGACATACGGATCAAACCCCGCACCGTACTTGTCGATCT
TGGGCTTTGGGAACACGCGAGCATCCACAGTGTTTCTCGGTGCCAAATACACGGCTTCTTCCTCGGCTAACGGCTTCGATTCCCcGTCATTGGCATCATC
AGACCCAATTGACAACTTCCGGCGACGCATCCTAGGACCTATTCCGTGCCCATCCTTCCACCCCATCTGGCTCAGTAGCTTTTTCCCAATGGAaTATTCG
TTCATTGGCTGCATGATCTCGTCTGGAACGTGGAACACAGCCATTTCGTGGCGTTTGGCTTCTCCGGACGAGATGGCGCTTTGCAGTTTCTGACGCGCTC
CTACTTGCAGAG