Description :
From Genome Similarity Track
Location :
Scaffold_169:92651- 95835
Transcript NameFunction/comments
g11385.t1hypothetical protein

Sequence
3184 bases(100 bases per row)
ATGCCCACATAGGCATGTGGCTCGAAGGAGGACGCGTACCCCGTGCTCCTGGTTTCGTACTGATCGGGTCACGCCGGTATGCTGAGTGGCAAAACCTAGC
GTTTCAAGCCACAACAGATCAGCAACCCGAGGAAGAACCAGACACGAGACCCGCTGGACCGATGGTAGACCGACCCCAGTACGTCACACCGACGAAGATC
TGGAGTCGAGACTCCGGGGCGTCGAAAGTAGCGGTCGCTCAAATCACCGAGTCCCGCCCTGTTGAGACGAAATCGAGGACAAATGCCCCCGGGATCAATG
GGGCGCACGAAGAGGGTAATCCGATCGCGACGGAGATGTCGTCAGACAGAATGGAAGAGCGAAGTGACGGGATGCCTATCGGAAGAGCGCCCATGATCGA
GCCGAAGACGCCGCCGATCACCAAGTCGGAGATACCAGATGACGACGAAGTCTGTTACCATGAAGGAGGCGACTTGTTCGCGGAGGATGTGGAAAAGCAG
ATGGCTGTCTTGCCTGAGGTAGCAACCACTACCGACGAAGTCACGATCGAAGACATTCAGGTGGGAGACCCTGATTTCAACACCCTTGAGGAGATCGATC
GTCTGCGGCAAATCATCTGGCGCCGGCGTCACCTACTGATCGGAAAGGGAAACGCGTTACCCCCGGCGGCTGTAGGCGCGGTGTGCGACATCGACGTTGG
GGGAGCAACTCCGGTCGCCCAACGCGTTCGCCGGGTCGCCCCACAGTTTCGCGAGAAGCTGTCGGACCTGATCAAGAGTTTGCTGTCTGCGGAGATGATC
GTTCCGTCGACCTCGCCGTGGGCATCCCCGATCGTGATCATCATCAAGAAGAACGGTGTTGACATCCGACTCTGTATCGATTACAGGCTGGTGAACGGAT
TGACACGACTGATGGTATATCCCATGCCGATGATTAACGATCTCTTGGAAGACTTGGACAAGGTGCTCTGGTACTGCTCCCTCGATATGGCCAGTGGCTT
CTGGGTGGTGTCTATGACTGAGCGAGCTCGGAAGATCTCTGCCTTTGTCACGCCATTCGGACTTTTCGAGTGGACGCGCATGCCTTTTGGGCTGAAGAAC
GCTCCACAGATTTATCAGAGGCTCATCGACAATGCGTTGTATGGTCATCTCCGAATCAGCGCTAGCCATGATCTGTCGACGCCGATTGATGTGTTCGAGG
CAGGGGAACCAGAGCCGGAACTGAAGCCGTCCGTGCTGGGAAGACGGTCGTACATCGACGACATTCTGGTTACGGCGACCACTTGGGATACTTTATGTGA
AAAGGTTGAGAGGTTGTTGGACGCTTGCGAACGCTGGAATCTGTCGATCAGCGTCGTCAAGAGCTTCTGGGGCCAGCGCAAGGTGGGTTACTTGGGGCAT
CAGGTGTCTGATGATGGTTTGGAAGCTCACCCGAAGGACCTTGAGGCGCTGAGTAATCTCCCCTTCCCGCTAACGCTGCGAGCGATGCAGTCGTTCCTTG
GAAGCTTGAACTACTACAGTCGCTTCATTGAAGACTTCGCGATCTACGCCGCCGTCTTATACGAGTTGCGCGAAGCGGACTTTCATGAGATCGGTCGTCT
AGAGAGGGTCAACCCTGGCCGACAAATGACTGGGGGCGACGAACCACAGATTCCGGACGCTGATCGCTGGACCCGAGCGAAGATCGCGTTCACAATGCTG
AAGGCCAAAATCGTGTCCACACCGATCCTAAAGCATTTCGATCCCGATCGCACTCCAGTGATCGTGGTCTACGCGAGTCAGTGGGCGATCTCTGCGGCAC
TTGTGCAAGAGCATGATGGCGTGTACTGGCCAGTAACTTTCACCAGTCGTACTTTGAAGTCCAACGAGCTCAACTACGGAATCGTCGACAAGGAAGTCTT
GGCGCTTTTACGGATGCTGGACGTGAACTACACCTTGCTGACGACGAGATCGATCTTGGTGTTGTCCAGGCACTCGACGTTGGCTTGGCTAGTCAACTCA
GCCGGTTTCCAGGGAAGACTCGGCAACTGGGCTGCGCTGCTCTCAGAGTGGACGTTAGAGATCCGGAAGTGCGCGAAAGGGGAAGATGAAATCCTGGGTC
TGGGTGCGATTGCAGCCAGCATCACACCTCGTGCCGAGGTAGACGAAGCGCTGATCGCGATTGCACCGGTGAAACAGCCTCGACAAACGATCCTCATGCC
ACCCCCTACGGTTGAAGCGGACGAGAATTTGTTAGTCGCGAGCTTCGATGGATCAGCACGTGTTAAACGTAGCGGTGGGGCTTACAGCGCGATCATATGG
AAGCTCCCCGAGTGGACGATTTTGTCAGCCGCGTCGGAGTACATGCCCGATCTGACCGTGAACGAAGCTGAGTACCGCGGGTTGTTGTTGTGTTTTGATC
TGCTGTCGACTTTGGACCGGGGGCGGATCGTGATCTGCGGTGATTCCAACCTGGTGATCCGCCAGATGCGTGGTGAGATCGCGTGTAACGCGCCAGGCCT
GTTGCTGTTGCGCCAAAAGGCAATGGAACGGCTCAGATCGTGGCCGAAACACGAGTTCCTGCACATGAAGCGAGACTGGAATCAGAGTGCAGACAAGTTA
GCGAGCACCGCTCTCCAACGAGAAGAAGGAACTGTGATTACCTCAGAGGGTGATCGGCAGGACTTGGTCACACTTAACCGTCTGGATGAGCTTCTCAAGC
CGAAGGATGACGACAGTATTGTCCGGGTGTCCGCGGTGACTAGATCAACGAGGCGTCGGCGATTGCCGCCCGAGGCTCTGCAGGAAACGATCATTCAGCG
CATGCGAAGTAAGCGAGTCGTCCAAGCCCAGAATGAGGAGAAATGGATCACCGACCTAAAGGCGTACCTGAAGGGAGACGTCGGTAGCTTGACTGCGAAG
GAAGCCAAGTCGTGTGCGAAGATCGCGGACGATTACGAGCTGGACGAGAGCGACTTGTTGCTCTATTGTCCATCATCCATAACGCTGGACGAGGATCGGG
ATGAGATCGCAAAGTTGGTGGTCCCAGAGACTCTGCAGCAAGATTTCTTACATCACTATCATGCGAGTCTGGAAGGAGGGCATCAGGGGATCGGAAGAAC
GTACCGACGAATCCGATCCCATTTTCACTGGAGAGGCCTGTACCGAAGTGTCCAACGCTACGTGGGAGAGTGCACAGACTGTGA