Description :
From Genome Similarity Track
Location :
Scaffold_11:92640- 108903
Transcript NameFunction/comments
Phymu_g851phospholipid-transporting ATPase, putative
Phymu_g852hypothetical protein PHYSODRAFT_353483
Phymu_g853hypothetical protein
Phymu_g854hypothetical protein

Sequence
16263 bases(100 bases per row)
GATGCTGCGCGTGTCCTCTCTGTTGCGCGGATTAACCTCCGCGCCAGTGCGCCGTCGCACCATCCTCAACCACTCTGCATTGCGTGGATTCAGCTCTCaa
gatggcgatggcgatggcgatggcgatggcgatggcgacggcgaggacgaggaggaactggagctggacgagctggaactggactgggacgacatcgacg
acgtggacgaggcATGGGAACTGAACGACGAGGGCGACGTGGCTTCTTCTGGCCGCCGCAAAGTGGAGGAGCATGTTAAGCGGAAGGTGAGTGTGCGACG
CGCACAGCACTCCAAGCGCCGCTTCGTGGACCGCATTCGCGTTAAGGCCACGGGCGGCCACGGAGGCAATGGATGCGCCAGCTTTTTCTCCGAGTCGGCA
ATGCGCAAACGGCCCAATGGTGGACACGGTGGGGCTGGAGGTGACGTGGTGATCGAAGCCAGTGACAAGATGCAGAACCTGGGAAATGCTACGCACCACT
TCAAGGGCGGAGCAGGCACTAACGGCATGCGTACGGGTGCTTTTACTGATAGTTGTTATATTGGCTTAGCGATACTGACTGATGGCTTTATTGTGTTACG
TATATAGCTAACGACTCGGCCGGTAGGAGAGGCAAGCATTGCCACGTGAAGGTGCCGTGCGGCACGCTAGTCAAACGCGTGGAGCGCTATGAGCGAGAAC
TAGATGACGGCGAGTGGGAGATTGTCGACAGAATGGAGGTCGTAGCTGATTTAGACAAGGCTGGTGCTTCGTTTCTAGCTGCCAAGGGTGGCAAACCTGG
ACTAGGCAACCGGATTCTGACgggcaagacgacgaagttTGGAAGTCTACGCAAATTCATGCCCGAGAGCAAAACCACGGGCTCGCCTGGTTCGTCGCAG
TACTACGAGCTGGAACTTAAGACGATTGCTGATGTGGGTCTTGTGGGTTATCCCAATGCTGGCAAGTCTACCTTGCTGAGTGTGCTTAGTCGTGCTACGC
CTGAGATCGCACCTTACCCATTCACGACGCTTCACCCGTACGTTGGCATTGTGGAGTTCCCGGACACTTTCCGGCTGAGTGTGGCTGATATTCCCGGGCT
TATTGACGGTGCGCATCGCAATGTTGGTCTTGGTCACGACTTCTTGCGCCACATCGAGCGTACAAAGGTACGTGAAAGAATGCGTTTAATTATTGGGATT
GCATGCTGACTGAAGTGCTGTAGATTTTGATGTATGTGCTTGATACGGCGGGTTCAGAGGGACGTGACCCTATGGAGGACTTTACACATCTTCAAAGAGA
GTTGGAGCTATACGCCCCTGGAATCTCGTCACGTCCCTCTCTGATCATTGCTAACAAGATGGATGAACAAGGTAAATGGGGACGTACTCTGGCAAGAAAG
TTGCACTAGTTACTAAAAGATTTAAATTGTGCGTGGTGGTTCTGCTGTAGGTGCTGAAGTCAACTTCCACAAGCTGCGCAAGTCCACTGATCTTGCCGTG
CTCCCAGTCAGGTAAACGCTTTTACACTCTTCAAATTATGCCTACTGCGAACTCAATCGTTATCTTTTTATGCCGTTGAATTGAACAGTGCACTTCACAA
GGTTGACATTGATACGGTAGCACGTACGCTCCGCTGGATGATTGAGAGCTACAGCAAGCTTACTAAGTCCGCATAGACCGAGTATTACCTTTATGCTCCG
CAACATGAAGGGGTTACCCAAGAACTCATCTAACTTTTGTCGTAATTTCGTGTAATGGCGTGGTTATTAATAAGGTGCGGTCTTGTTTTTAGTTTCTCAC
GACCGACTTCACAAGATGAATCGCTATGAAGTGCTAGATCGGGTTGGTGACGGGGCTTTCGGTGAAGTATCACGTGCCCGCAGTCTCAAGACTCAAGAGA
TCGTTgctgtgaagaagatcaaggcgTTGTTTCCCACGTGGGAGGAGTGTCTTCAGTTGCGTGAACTAAAGTCACTCCGTGTGCTGCGCCATGAAAACAT
TGTGCTGTTGAAAGAGGTCATTCGAGACAAAGAGGAGCTTtacttcgtcttcgagtACTTGCAGACGTCACTTTTTCGGGTTATGCGGAACCTCAAGAAT
AGCGACTCAAATGGTGCAGGAGCCGAAACGACAGAGCCTTCATCACTGCCACATCCATGGTTCTCGACTGCCCAAGTACGTTCAATTATGTTCCAGCTCT
TTAGCGGCCTCGCGTACATGCACAAGCACGGCTACTTTCATCGTGACATTAAACCTGAGAACCTGTTGTGTCATGATGATACACTCAAGATCGCAGACCT
TGGCCAAGCCCGCGAGATCCGATCAAGGCCGCCGTTCACGGACTACGTATCAACTCGGTGGTACCGAGCACCTGAGCTGTTACTCCGCTCGACAATGTAC
AACAGCCCCATCGACTTGTGGGCCTGCGGGTGCATTTTGGTTGAACTGCTGATCTGTACGCCACTGTTTCCTGGTACATCGGAGGCTGATCAGTTCTACC
GCATCTGCAAGATTCTTGGTACACCTACCAAAGAGACGTGgcctgaaggagcagcaatGGCCTCTCAAATGCAAGTTCGGCTCCCCAAGTGTGCTCCTGT
ATCTTGGAAGCGATTTCTTCCTCAAGGAACACCCTCCTCTGCTGTTCAACTGGTACAAGACTTGCTTCAATTCGATCCAAGTCGACGTATTACAGCCGCA
CAGGCCCTTCAACACCGCTTTTTCGAGCAGACCGTGACACGACCGACACTAACAATCCCCCCGTTGGTGATGCCCGAGGAAGAAGTGCCTGTGCTGCCAC
TCCGAAGTGAATACAAGTCGGTGGGGGGATACTCGAGCTACACAGGGCGTTCGAATCTGTGTACGAAAAAGTCAGACGAAGTTCCAGTGAGTGCTGTTGA
GGCTTCTGGTCTTTGGGCTGGGGGTGCGCTGACGTCGCGACACGAAAACCATTTGTGGACTGCCAAAGAGAGGCTACAAACGCACACACGGCACCAGGAA
TGGGGCTCTTCACTTGTCAGTGCTCGTCCTGGGGTGTTGGATGATATTAATACTGCTTCGATGCAAAACAGGACAGGCTCATTCACAGGAagcttggtga
agaagagctcgagctACAACACGCTAGTgggcgaaggcgacgacaGCTTCTACTCAGCAAGAAAATGTACGCCGGATacgaccagcgaagaagatgccaa
AAGCGACAGCACACTCCTTCAAGACCTACTTGATGAAATTCTAGGCTAAATCATAATAAACTCGCGTTTGGTGATAATTTCATCAGGTATATTGTTCCTT
TCATCGCAGTCCGACGTACGTCATGCAGCTACATAGCAGTAGCCACTTAGAACTTCAGGGCGTGGGCACGGTCGTTCTTGGTCAGAGTGAACTTGGCGTT
CAGGTAGGCCTTGAGGAACGGCTCGGcgtcgagcttcttgatcagAGCCGAGTCAACGGCCTTCTGgtccttcttgcgctgctccgAGATGACAGGGGCC
TGGAAGGATACGGCAACAAAACGGTAAGTGTCTTATAGGGAGCTTATGTGCCGAAGCAAGCGATCCCAAGCGCTCATGTGGTATGACAGGGGGCTATGTC
CGAAGACGTCAACTTCCCTGCCTGGTCCGCCACGCACCAAAGGGATCGAAACCAGAAAACCAAGAGAGATCCCAGTGGGTTCGTCAATCTCAGTCCCCAG
CGTCACCACTCCGTTGCTTGTTGTGAGCGAACCGTGTGAATTGGTCCTAAAGAACCGACCAACCGGAACGGGATGCTTACAAAGCAAATAGAAAAGGGGG
AAATACGTACGGCGCTCGACTGGGCGAAGAactgctcctccttgctcttcttggcggccttctccttggcgaagTAGGCGTCGTCGATAGCAGGAAGGGC
CAGGCCCTCAACGTTGACCTTGGTCGACGTGGCAATCACGTACGACTGGTTCACGCGACGAAGGGGCACACCGTTGACCTTGTAAGGGCCTGAATTGTCA
CAACAAAGCAAACTGTTAGCAATCGATGCTATCAAGAACAAGTTCCGAGTCTCAACGACAACTAGCCAGCATTCCTCAGGTCTCATAATCTGATGGATCT
TCGGCGAAAATAAACTCCCTCCCGCCCACAGCAAACCCccaacagcaactgcatGCCACAAACCGACGGCCTCCATTAGAAAACCGTAAACGGAGTCATT
GGAGGGAAGCAGACATGGGGCACCCGTCGTGGAGGTAGGAGCAGACGTGAGGGAGTGGCAGAGCGCCTCTCGAAGTGTCAAGTTTGCATCATCGGAATGC
CTGCTGATTAAACTTGAAGTATCGACTTACcagtgacgagcagcagacccgaagcgagctgcttcaggaACACGACGCGCTTGCCACGGAAGCGGCCCGA
GAGCAGGATGAGAACCGTGCCGGGGGTGATGGACTTGCGCAGCTTGGCGGTCTTCACGCTGTTACGCTTGGTCTTGGCCGAAGGCAGCGGCTTCGGGATG
TAGTCAGCCGGGTACCACTTCTTGGTGGACACCTTCTTGGCAgcgaccttcttctcgccgcCCTTCTTGACCACCTTGCCGCggccgttcttcttcgaga
gGCTGTTGGCGGAGATGGCGTTGATGCCACGGGCAAGGACGACGTTCGCAGTTTTGGCGGGCATGGTGATGAATATACCTATAGAGGAAGAAGGTTAAGT
GGCTGCACGACGAACTGCCAAGGAGCACGACATGACGGTGGACGCTTACCTGTCTGAAAAGAACTGAGCCAGCAAAAGACCTGAACGCCGCACGAGAGCT
ATCCACAGCCAACCACAGAAGATGAGTGTGGTGTACGCAACATTCATTTTGAGGTACAGCGTACCTAAAATAAAGCGGTTCGACGGTTCAATAGGACCGG
TTAATGGTTAGGTGTAGAATGCAGAAATGTGCCGGTACGGTACCGGTTATATTTTTGATTCGGTATTTACGTAATCCATGAGCCATCCGGATCCGGATAA
GCATTTTATGTTGCGCTCAAGTTGCCGAATAAACTATGCAACATTTCCTAACGAGACTTTCTTGAAGCAGGACAGAGAGATCGCACCCTTCTCCGTGTTG
GCACTGGCCTCCGCGCTGCCGACACTCACTGTTGAACGCACCGCGACCTGAACAAGCGTCTCCTAGTGGCATACTGAGAAGAAGTCGGTAAGGCATGGGC
AAGCGTAAGGGACGTTGTGCCACCGCGAACATAACGCAGTCGGACCCTGTGATCGAAAAGACGCAAGAGTTTTCGGCTGGCGGCTGCTGTggcagcaaga
gcgacggcgcAGAGACTGTTGCGTCATGCTCCAGtagtgacgaagacgtcaagtTGCCCAAGGCAGAGGGTGAAGCaggaggctgctgctcgtctaaagt
tgaagaggaagtgggcggttgctgctccaagaaagagaagaagaaagagggacgctgcagcaagtctTCAATGTCTGATGAAGCTGTGAACGGTGTTGTT
GGGGTGGACAACTGTTGTTCAACTAAGGATAAACCTAAGGAAtcgtcaagttgctgctcttcaaacGTAGCAGGGTCTTCCGGCGATGccggctgctgct
ccaagaaGTCGCCAGCTTGGACTGGTTGTTCATCGGAAACTGGTGATGCTGTACGTAACGGTGGGAGCTGTAGTGCGAcaaaggacaaggagaagaattC
GGGCTGTTGTTCAAAGGAGCGAATGatcaacaacagcaaagcTGACGATTGTTGTGCCTCCAAAACGGAGCCAAAGACGTCGGGTTGCTGCTCTAAGAAG
TCAGAgatcgaagtcgaagttgacgGTTGCTGTTCTTCTACGAAGGAGTCCAAGAAGGCAggttgctgctcgtcgtccgcaaAGGATACAGGGAACTCGT
CTGGGTCGGGCTGTTGTTCGTCGAAATCCAAGGACTTACTACTTTCTGAGAGATCGCCCAGTTTCTTAAATCGCTTGGTGCAGTTCCGAAGTGACCGGGG
AGCCTCGCTTGAAAAGCAGCGGGCGCACTTGGGAAGCTCGGggaaaaataaaaacacGAAGGATTCGCTGGAGATCCTCCGCTTGAACATTGGTGGTATG
AcgtgcagtggctgctgtacGCGTATCGAAAAGTTCATGATTTCTCAACGTGGTGTCACGGACGTGAACGTGAGTCTGCTCACAAGTCGCGGAATCTTCC
AGTTCGACCCGGAGCTGGTGTCGGCGAAGCACATCGAGGAGACTGTGGCCACTTTGGGGTTCGAGCCCAGCGTACTATCGAGCGATGAACTTGTCAGTGT
CATCCTGCATCTCGGCCCGTCGGAGAGTTCCTATCAAGCCAAAAAGTTGTCGCTCGAGATTGCTGGCGTCGTCTCGGCTGAGGATATTGATGAACCCATC
GTatcttcgacttcctcgGGCAAGTCACTACTAGTGGAGTACAACCCAGACATCGTAGGAGCCCGTAGAATCGTTCGTCAACTCTCCCGCGAGCTTGGAT
TCACTGTCCAAGCATCTAGTCCGCGAGCACCGTCGGTTCGTGCtggcgaggaagaagttcgacgCTTTACGCGCCTTTTACTTTGGAGTTGCCTGCTGTC
TCTCCCGGTGATCTTCGTAGAGTTCATCCTGCCAGCGCTTTATCCATTTGCCGACTCCAATCCGGCAGATGCGGGACTTTGGGGCACCGCAAACCGGTTG
AGTATCCGAGATGCTATCGAGCTGGCATGCGCGACGCCTGTCCTGTTCATCGTGGCGCGCCCCATTCATGAGAGTGCCTTTCTCGCGCTGCGTTACGGTG
GACGCGTTACTATGGACGTGCTTATCTCGCTCAGCGCTTGCACTTCCTACGCGTTTTCAATTTTCACTGTGGTTGCTGGAGCGTTCGCGGAGTCTCAGAT
ATCAGACGCAGTGCCGACTCAAATGGATCCTTCAGTGGATCttccgcagcagcaagtggagacACCAGCCAAAACGGAAACGTTTTTCCAGGTCACTGTT
CTGCTCGTTACTCTCATTCTTGTTGGCCGCTACATCGAAACGCTGGTAAAGGCGCGTGCCTCGAATAGTGTGGATGCATTGCTTCGTATGCAAGCCAAGA
CGGCCATTTTGATGGAAGAGGGCCAGAAAGAGTTGTATATcgacgtggtgctcgtgGAGCGAGGCGATCTGCTGAAAGTTCTTCCTGGTACTCGGATTCC
TACGGACGGTGTGGTTGTCGGAGGTGCAAGTTCTGTGGACGAGTCGATGGTTACGGGTGAAGCTCGCAAAGTGCCCAAAGAGCCTGGAGCAGTTGTGATC
GGCGGGTCTATTAACACGCAAGGTGTTCTATCCATGCGGGTAACCCACACCATTCATGAATCGATGCTGGCACGCATGGTGCGCCTCGTAGGAGAGGCCC
AGGCTTCTCGCGGTGTGCGGCAGAGCATTGCGGATGGTGTGGCTGCCTATTTTACAACGTTCATCATCGTCCTGGCTGGCGTAATGTTCGTGCTCTGGTA
TTCTCTCGCTAAGCACGGCAAAGTGGATACGCAAGGCTGGGCTCCTTTCCCGTTCGCGCTGCGCTTTGCGATTACGGTGCTAGTGATTAGTTGCCCCTGT
GCAATTAGCTTGGCCGTGCCGACTGCTGTGATGGTCTCAACAACAAAAGGTTCCCAGGTGGGTATACTTTTCAAGGGCGGTCGCGCTTTGGAGGCACTCG
AGGAGGTGGATGCAGTCGTGTTTGACAAAACGGGTACGCTTACCACTGCAcaacttggcgttgctggGGTCTTCACACCACCGAATGACATGAATGAGTT
AAAGCTCTGGCAATACGTAGCTGCCGCAGAGAGGGATAGCGAACACTCTATTGGAAAGGCCCTTGTGGCGCACGCTGAGAACCAGATCCAAAGCactcaa
gtcgaagaagcgcaaggtTTTGAGGCCGTTCCAGGTTGCGGCGTttactgtactgtacgaGGTGTTGATGTACGCCTTGGCTCACTTACGtggctcaagc
agcagacgtaCAGTGACTGTCGCGCACTTCGGATTCCTCACGAGTTTGTCGAAGCAAACACACGTTTCCAGTCCCAAGGCAGCATAGTGGTGTTCGTTGT
AATTGACGGCGAGTTGGTATCTGCGATTGCTCTACGAGATGCACCGCGACAGGAATCAAAGCGTGTAATTGAGCAACTGAAGCGCGATGGAATCCAGTCG
TGGATTGTTACTGGTGATCAGCGTGGAACGGCAATGAGCGTGGCGAAAACACTGGGCGTACCTGAAGGCTCTGTGCTGGCTGAGAGTCTGCCTCATCAAA
AGGTAGACAAGGTGCGTCTACTGCAAAGTTTGGGTCTGCGTGTTGCTTTTGTTGGAGATGGCGTAAATGACGCCCCAGCGCTTGCTACAGCTGATGTTGG
AGTTGCactcggagctggaactgACGTGGCGCTCGACGCTGCCGACGTCGTGTTGGTTAAGGATGACCTTCGTGATCTCCTCAACGCCCGCGCACTTTCA
AATGCCACCAACAGACGTATCAAGCACAATTTCGCGTGGGGATTCATGTACAATCTGCTCCTGATGCCAATTGCTTGTGGAGTGTTGTACGCCCCTCTAG
GGATCTGGATACCTCCGGCCCTCGCTGGGTTGTCGGAGCTTTTATCGTCCGTGCCTGTGATCCTGTTCTCACTGCTGCTAAACCTTTGGAAGCCACCATT
CAGTGGTGACTGGGGTCTGGAGCAAAATCACGTGGCGATCGACGTGACTGAGGCGACACCTCTGTTGCGGAAGCAACGTTAGTGGACGAACAAGGTAGAC
TATCGTGCTGGAATTAACTGGTTTGATATTGTTTTATGTGGATTCTTTTTTTCTGCTGTGTGTCCCTAGCTAGAGGTAGAAGCTTTCGCATACTCAAGGA
ACGCTGCTTTCGCGTGCATCCGTGCCGCGTTTGAATCTGCTGACAGTGTCTTGTCATCACTAGGGCTACCGGCGACGATAGCATCgaagcgatgacgaag
taGCTCGATGTCTTCGCTTGCGGATCCACTATGGTGAGTGTCATCTACTTCACTGTCGGCTACTGAGTCTTGGGCTGCACGCATGCTGCGAGCGACTTTC
ACGCCTGAACCACAGGATGGATGCGTTGGCGTCGAGGCAGCTTTGAGTTTTTCTCCAAGTCGACAGTCGTTCACGAAGGCGTCACGACGTGCGATGGCTT
CCAGTTCAGCTTTCTCTTGCCTCCGTTCTTGtcgttgcttctgctcctcgtccggttcgtcttcatctcgagcAGAACGGGGGTCAggcttcatcttcag
ttTGTGGCGGTGATGCAGTGCCTTAAGTGAGAGGCCAAGAAAGAAACAGGCTGATGAACGCGTAGACATTTGCAGGAACTTTGGACGCTCGCTGCCGAGC
GCAAGAAGCACCTCGTTGAGAGCAGCTCCTAGATGCTGCTCCAATTGACCTGGATAGCTCTTAGCAAGTGTCACTTGGGGTGGTAACTTCACTGGCAAGC
TCTGTGAGGTGTATCGAGATGGTTCGGCGCAGAATTTACGACGGGCGTCCTCggaaacgaagaagaagactttGGAACGATATGAAGcgcggaagaagac
gttaCCATGACGAAGTGCAGCCCAATCTTTGGCGCCCGAGCCCGACGCAAATGTGACTGGGCAGTAGCCTTTCATTTCGGGGAAATCGCAGTCCGGTACA
ATTAGCAAGCTCACGAGCGAAGCATTGACTGGAGCTCTATCCACAAGTGTCTGTGCCTCgctctctgcttcttcttgcgtcGGCCAGCCCTCGTCTTCTG
GTTGAACTGGAGTTTGATCAGGCAAGTACCCGATGAAGGCTTCAGGGCTCTCCATAAACTGCTGGAGATTTTGTTCATTCCCAagccagaagctggagcc
TCGGAAGTCTACACACAGATCGCGTTTGGATGGACGCGAGTGGTAAAACCTACTCAAACGAAGTTCAACAGGACAGAACGTCTGGAAAGCGTTGTGCTGA
CGCGCTTGGAGCTCTCCACGAGTGCGTACCACACCTAACGAGCGAGTAGTTCGATTGGAAGCCATTGCTCTAGTATGGTGCGATGCTAGGCGCTGTTGCT
CGTTAAGGAGCGCTTGGGCTTGCGCAGCTACGTGCCAgagcgagctgcttgagctaTCAAGCTGTCGCACGTGGAAAGTACCGAAGCGTTGGGTCCAAGT
GTGCAATAACTCTAGACGGTAATGGTGCCATCGAGAGAAGGCTGTCCGCAGCTCAGGTCTATCAGTATGAGTCTGATGCTCCTGCCAGACGCCAGCAAAG
TCGCGTTCCAATATGAAGAGCATGTCTGGCTGGATATTTTGCGACCCTGAGTTGAGACTTCGGTGCAGCTCATGATGCTGCAACATATACCCGTCGAGAA
CCCAGCCACGCGCCTGGCACTCCGAAGAGCGAAGACGCGTGCAGACAGCTTCATGCGTGACATCTGGGTTGGCGAGAGGGTCGGATTGCTTTTGTAGCCG
AAGGCGCAATGTTGAGCCACCTTGACACTGAATCACCCAGTCTATAGCCGATTGGGGCGAGACGTAGATTAAGCCGAGCGCGTTTGCGAGTTCCTGAGCC
ACTCGTGTCTTGCCTGAAAGAGGAGGTCCTAACACACAACAGGTTGGTTGATGTCTCGGTGGAAAACTTGCTGAGTTCAAGTATCTCCACGGACAAGAGA
TGAAAGAACGGCGGGCCTCACGCGATCGTGGAAAGTAAAGCTGATCTCGATGAACAACTGGCGCTACGTCGGTAGCCGATAATGAATCCGTGCGTCCAGT
AACAGGACAAGCGAATCCATGCTTGCCGACAATCAGCTCGCCTGACGCTAGCATCTGATGCATTTTACCCGCCGCTGACATGTCAAGAACCTCACAGCGC
TCAAATAGCGTCTCTCGGCCTGCCATAAACTCGTCAAGGAGTCGTCTCACGTGTTTGACGACTTGTCTTGGTGCTTTGAAAGCGTCTACCGGGTTGCAGA
CCCTGATGCCACGTGCttgaagaccagcaagagCCTCATCCAAAGCTTTTTGGTCCTCGGCAAATTGCTCGTTCAGTCGAGtagtctcttcttctcgcgc
aACTTCCAAGTCAATAGgttcctctgcttcttcgtcagcttctggaggactatcgtcttcagcttcatcatcgccCCCTCGTTTCCGTGTGATGGCAAGT
TTTCGTCGAGGAGCTGGCAGAGTTGCAGCCCACCGAGTCATCAAAGTGGCCACGACGTCCTCTTCGGACACTGTTAAAGGCACCACAAGTGTTGGGAAGA
GTCCGTTCCTGAAACACATCTCCAAAGTAGCAGCACTTGGAATTCGAGAGGCCTCTGGTCCCAACCCGGCGATGATCTGTGCTTTGGAAGTAGTTTGGCA
ATGAAGCTGGAGTTGAAGCGCTCGTACGAAAATTTCCTCGGAGGTCAAGCGAGTTTCTTCCGCTTTcagttcttccagcagttggTTACGTTCGGCAATC
CCCGCTACTGCAGCCAAGTCCACATTCGCGTACGCTGAGGAAGATTCGATTTGTTCCGTTTGCGTCTGAGCTAGGGCTGTAGCAATCCGACCACGCCCAG
AACCTCGAACaccgaggagaagcacaCAGGGCACTAAGCTCGCGGTTGCACATGGATTTTGGGGGATGAAGGCGCTTGGATTCCGCTCGAAAGTACGTTT
CTCGGGTTCACCAGCGAAGGCGTAAAATTTTTGCCGGAACAAACAAACGCTTGATGGCAATCCAGGTACCAGCAGGCCACGCGTACGCCAAGACACGGGG
CAGAAATGTCCACATTCgccttgaagttgcaggGCTCTGATCCTCGCGGCTTCGGCTTGAGCTTCGGCCTCAGGATctgtggcttcttcttcctccgttG
GCGACTTTATaccttcttcctctttctctgGAACCGGTGAAGCGAATATTGCGACTGGGTCGTATTCATCTACAAGCTCTGGAACATGCCCGTCTTCGAC
TCTGTCCACCcgaggagctactggatTCAGTTCTCGTTCAATGGCTGCCAGCGAATCACCCGATTGATGGAATAGCGGGCAAGTTATGACTCGAGGAGCG
CTGCCAAGCCCTAGAACAATTTCCTCCGCGCCAGCCTTTTCAGCTTGGAATTGCTGGCGTCGCAGCACTGATAACGCGCTAACGTTAGTGGCGTCGGCGT
TCGTACTTTCACCCTCTTCCTCTCTGTCCATCAAGAGAATTGTGTCTGGCACGCAACCGTGTTCAAGCAACACAGCGGCGACCTCGCGCGTCAATGGCAG
ATCCGTGATCATCCACCCTGGGGACAGTTTCGACTTGATCGTCTCGGCTACAACTGTTGCAGCTTCAGTATGGGAGACGACCTCTCCGGCCATGAGCCTC
ATTTCCACGGAGATACTTGGTGAAGTCTTGAGTAACTTCGAAGGAGACACTGTCTGTACGTGGAGTCCAGTCGCAAGTGTCTCCAGGTAGGAAGGTGTGA
AGATCTCGCCTGCTCCTGTGGTAACGAGCCAGAAGGTTCGATACGTGGATGGCACTGGGATATCTTGGCGCAAATATTGAAGTGGGTGGGCACAGAAGTC
TCGCTGAGCGGCTTGAGATGTGAAAAGGTAGACTCGTCCGGAATAACAAACAGCAAACTCCGGTTCGCCGAGTTTCAGTGTGTTAGTTGAAGTCGACAGC
ACAGGGCAAAACTCGCGCCATTTTGACAGAAGGCGGCGTTTGACATCACGTTTAGGCAGTCGAGCGAATGACTCTGAGGTGGATCTTGCTTCGACCTCAA
GAAGCGTACTCCAGTCTCCATACAGCAACCACTTGACTTTTTCGCTACGACTGGAACCAGTTAAATCCTCGGGCAGGGAGATCGGACAAGCTTCACGCGA
GACGCTGAACCGCGACAACCCTAGAGAAGTCTGAATAATTTTGAAAGCACAAGAGTTAGGCGATgattgaagacgaagcaggaAAAGTATTTACCCCTGT
GATCGCCCGGATGCAGTGGTCTCGGATTACGTTGAGTGATTGAGTTGCCAGAACCACCACCAGGTGATACTCTGGCACGTTGGTTGTTCGATAAGTGGAG
AGTTCGTGCTGCATACGTTCCACATACGCGTGATATCCTTTCGCGAATTTCACCATAGACATTGAGCCTAATGGCAAAGTCGGTTCTCTGGGTGGTTCGA
TCTCATTACGTTCTGCGGGTGTTGGTTCCGGTGGAGACACAGGCTTTTCCGTCGGGGTTTGGTCGCTGTCTCcgttctcttcctggtcTACTGGGGGAGT
CTCCaattcctcgtcttcgtttAAAGCGGCCTCACCACTTTCAACAACTACGATAGGCTCTGGCACTGCCTCAGTTTCTTCCTCTGACTTCTTCGGTGGC
AAGAGGAAATCTGCGAAGCCTTGGGCTGCCAACTCCTCGTTACTTGTCGTCTTCAATGTTGCAAGTTCCCGTGCTGAGTACAAACGACCTGCTACTGGGG
CTAACTCCGCGCCGTGAAGTTGACACTCCAATTCACTGGGTAAAGCTGTGAGAGCCACCAAATAGTCTACTGTTACGCTGTGCTGGACGTCCTCTGACAA
TTCGCTCGGGTACACATCGTCCATCACTACCCCGACACCAGCTACAACAAAATATCACAGACACGCCAGTGAGTATCATTTTTCCTTGCTATCTTGATGT
ACTTACGCACCAAGTAAAGAGCGAGAGGCTTCTAGTCGTAGTAAAGCAAGTGCTGTGCTTCTAGGAAGGACATTCCCAGTACAAATTGCATTGAGATCTT
CCTCTCGAAAAACACGATCCAtctcttcatccacttccGCATTATTCTCCTCAGATTGTTCGTCTTCTGGTGGTATTTCCATTGGTGGAGGTGTTTCGGC
ATttgcatcttcttctgatGGTGTAGCAATAACTGTTCGGTGCCTACGAAGTCGGAGTTTACGGTCGACGGCACGTTGAACGGCTCCGCTGAGAGATAAA
TACTTGAGATCAAGACGCCGTGCAAGGACATAAGCAAGCCGCGTCTTACCACTCCCAGGTGGCCCAACAACTGCGACTTTCAGAGCTGGAAACTCTGCTA
AAGCAGCAACGAGAGCATCTTCAGGGTCCCAATGAGCTGCAGTCTCACGATGAAGTTTTCTTCCTCGAATAGGAGTCGCTCCTGACCCAATAGAGCCCAC
AAGTTCCAAATGCAACCGTCTTGCAAGCTCCATATCGTCTTCTACAGCAGTTTTAGCGATATCTGGGGCTTCTGGCGTACCTTCTTCTGTAGCATTCGAC
TTGTTTTTCGGAAATGCACGAGTGAGTGAGAATTTCCGCGGGTTGTAGCTAACAAGAAGCTGTTTGAGCGACATTTCGCGTTGATCCGGAGGTTGTAATC
CTCGAATACTCCGCATAGCATCGCTTGATGGAGGGAGCTTTTGCAGGAACGAATCGTTGGCGATTTTCGGGATCCGATTCAACGGTCTCAACGTGAATCG
GTCAACCGGATCAGCTGAATTGGCCTCATCCTGTTCCGGTTCACTGGATGGACAAATAATCTCCGCGACGGAATGACGTAACGCTCTGAAGAAAGCCAAA
TAGACGGTGGCTCCACTCTCCACGGGTAGAACAAGTTCTGCAATCTGCATGACAGCTTCACGGAATTGTTCAGGTGCCATCTCTTCACTGTCGAAATTTA
AGGGTGCTTTGTCGAATTCAGAGCTACGACTGACGCTTTCCAAGTCATATTCCCAGTCCCGTTGCGCTGCGGCAATGGCGATTGCATCGGCTGATAATGG
CAGGACCAGCGCTTTAGCAGCTCGGGCGAAGAACGCAACGTATTCGTCTCGATTCAGAGTGCAGGAACTCACGGGTTTCGCCAAATCCCAGAGCAACGTC
AATTCTCCAGCTACCAACGCATTCACGTCGCCTCCGTTGGCAGACTCGGCGCCTTCCAGCATGGCATTGCGACGATTGTGCCATAGTTGAAGCAAATTGG
TTTTCCCTTCGCCCACACTGCGCTCCTTTTCGTCTTCGGCGAAGACGAAATGCCTCCGCATGGGGGCTCGGACGCCAGTTCTTAATTGGACTGACGGACG
GAGCGACTTGGGACGGAAGGTGGTTAGTTGGTTTCGTTTTTCATTCCCCCGTTTATAGGATTCGACACTCACTTATGAGTGCTTATAAGTGTGTCTTAAG
ACTTGAGTAGGTAGGTTGTAGTTCACCTCTAAGCTAAACTTCGAGATGTCAAAGTCACACGGGTCGTTTCGAGCGCAATTTCAGCACTGGCAGTACGGAC
TCTCGTCTTCTTTCCACTTGtccgctggtgcttcttcatTAACTCCTCacccttcttcttgatcatgTTACCGATGGATTTTCGTCGAGACTGCTTGGCT
GTGACCTCCTGTACCCACGggtgttgaagtgctgctgccactgaaAGCCTCGACTTGGGGTTCACATCGAGAAGACCAGCAAGGAGATCGATACACGAAG
TTGGCACCTGTGATAGCAGTCCAGTCTCCTGGAGAGCGACCTCCGAGCCACGTTCCACCATTcggttgaagagcttgtcACTGTCAGTCAAGGCTCGACG
CACCAAAGCTCGTTTTGTGCACATAGTCCACAGCATAACACCAAGTGACCAGGCGTCAGCGCTGCGTGCATCCTCGATCTCACTAGAACGTAGCAGCTCC
GGAGCAGCATAAGCTTCTTTAGCGACTTGAAGCACTTGGACGCTTGGCCGGTCGAGCTGGAACCGCTGGGCGTGGCCCAGATCCCCCACCTTCACGACAC
CGGATTCCGAGACGAAAACATTCTCCGGTGACAGATCCAAATGGACGATACCGATCGAGTGCAGCGCCTGTACGCCTCGAAGTACTGCGGTGAAGACTCG
ACGTCTACCGGAATCGGTGCAAGTAGTCACCGGAGAGCTCACACCGGCTGCCTGAAGGCGAATTTCTTGCTGCATGATCTCCAGGAGATCTCCCCCTGCA
CAGTATtcgtgcagcacgtggaGTCGCTCTCCTTGTAGTGAGTGACGCTCCATCTTGACAACGTTCTCAACGTCAGGAACAGAGAGATGCAGGTCCAATT
CGtgcaatgcagcagcactagcACTACGCCCttccgacgtggacgccgtcATAAGGGTGTGCTTGTCGATGAATAGCCGACCGGAGGCTGAACACTCGAC
CAGATCCACGCATTGAAGTCCAGAGAGACTTTCCTGTATACGCGAACGCAGCCTCAGAGGAGC