Description :
From Genome Similarity Track
Location :
Scaffold_11:92633- 115317
Transcript NameFunction/comments
Phymu_g851phospholipid-transporting ATPase, putative
Phymu_g852hypothetical protein PHYSODRAFT_353483
Phymu_g853hypothetical protein
Phymu_g854hypothetical protein
Phymu_g855conserved hypothetical protein
Phymu_g856hypothetical protein PHYSODRAFT_293744
Phymu_g857hypothetical protein PHYSODRAFT_293746

Sequence
22684 bases(100 bases per row)
ACGCGACGATGCTGCGCGTGTCCTCTCTGTTGCGCGGATTAACCTCCGCGCCAGTGCGCCGTCGCACCATCCTCAACCACTCTGCATTGCGTGGATTCAG
CTCTCaagatggcgatggcgatggcgatggcgatggcgatggcgacggcgaggacgaggaggaactggagctggacgagctggaactggactgggacgac
atcgacgacgtggacgaggcATGGGAACTGAACGACGAGGGCGACGTGGCTTCTTCTGGCCGCCGCAAAGTGGAGGAGCATGTTAAGCGGAAGGTGAGTG
TGCGACGCGCACAGCACTCCAAGCGCCGCTTCGTGGACCGCATTCGCGTTAAGGCCACGGGCGGCCACGGAGGCAATGGATGCGCCAGCTTTTTCTCCGA
GTCGGCAATGCGCAAACGGCCCAATGGTGGACACGGTGGGGCTGGAGGTGACGTGGTGATCGAAGCCAGTGACAAGATGCAGAACCTGGGAAATGCTACG
CACCACTTCAAGGGCGGAGCAGGCACTAACGGCATGCGTACGGGTGCTTTTACTGATAGTTGTTATATTGGCTTAGCGATACTGACTGATGGCTTTATTG
TGTTACGTATATAGCTAACGACTCGGCCGGTAGGAGAGGCAAGCATTGCCACGTGAAGGTGCCGTGCGGCACGCTAGTCAAACGCGTGGAGCGCTATGAG
CGAGAACTAGATGACGGCGAGTGGGAGATTGTCGACAGAATGGAGGTCGTAGCTGATTTAGACAAGGCTGGTGCTTCGTTTCTAGCTGCCAAGGGTGGCA
AACCTGGACTAGGCAACCGGATTCTGACgggcaagacgacgaagttTGGAAGTCTACGCAAATTCATGCCCGAGAGCAAAACCACGGGCTCGCCTGGTTC
GTCGCAGTACTACGAGCTGGAACTTAAGACGATTGCTGATGTGGGTCTTGTGGGTTATCCCAATGCTGGCAAGTCTACCTTGCTGAGTGTGCTTAGTCGT
GCTACGCCTGAGATCGCACCTTACCCATTCACGACGCTTCACCCGTACGTTGGCATTGTGGAGTTCCCGGACACTTTCCGGCTGAGTGTGGCTGATATTC
CCGGGCTTATTGACGGTGCGCATCGCAATGTTGGTCTTGGTCACGACTTCTTGCGCCACATCGAGCGTACAAAGGTACGTGAAAGAATGCGTTTAATTAT
TGGGATTGCATGCTGACTGAAGTGCTGTAGATTTTGATGTATGTGCTTGATACGGCGGGTTCAGAGGGACGTGACCCTATGGAGGACTTTACACATCTTC
AAAGAGAGTTGGAGCTATACGCCCCTGGAATCTCGTCACGTCCCTCTCTGATCATTGCTAACAAGATGGATGAACAAGGTAAATGGGGACGTACTCTGGC
AAGAAAGTTGCACTAGTTACTAAAAGATTTAAATTGTGCGTGGTGGTTCTGCTGTAGGTGCTGAAGTCAACTTCCACAAGCTGCGCAAGTCCACTGATCT
TGCCGTGCTCCCAGTCAGGTAAACGCTTTTACACTCTTCAAATTATGCCTACTGCGAACTCAATCGTTATCTTTTTATGCCGTTGAATTGAACAGTGCAC
TTCACAAGGTTGACATTGATACGGTAGCACGTACGCTCCGCTGGATGATTGAGAGCTACAGCAAGCTTACTAAGTCCGCATAGACCGAGTATTACCTTTA
TGCTCCGCAACATGAAGGGGTTACCCAAGAACTCATCTAACTTTTGTCGTAATTTCGTGTAATGGCGTGGTTATTAATAAGGTGCGGTCTTGTTTTTAGT
TTCTCACGACCGACTTCACAAGATGAATCGCTATGAAGTGCTAGATCGGGTTGGTGACGGGGCTTTCGGTGAAGTATCACGTGCCCGCAGTCTCAAGACT
CAAGAGATCGTTgctgtgaagaagatcaaggcgTTGTTTCCCACGTGGGAGGAGTGTCTTCAGTTGCGTGAACTAAAGTCACTCCGTGTGCTGCGCCATG
AAAACATTGTGCTGTTGAAAGAGGTCATTCGAGACAAAGAGGAGCTTtacttcgtcttcgagtACTTGCAGACGTCACTTTTTCGGGTTATGCGGAACCT
CAAGAATAGCGACTCAAATGGTGCAGGAGCCGAAACGACAGAGCCTTCATCACTGCCACATCCATGGTTCTCGACTGCCCAAGTACGTTCAATTATGTTC
CAGCTCTTTAGCGGCCTCGCGTACATGCACAAGCACGGCTACTTTCATCGTGACATTAAACCTGAGAACCTGTTGTGTCATGATGATACACTCAAGATCG
CAGACCTTGGCCAAGCCCGCGAGATCCGATCAAGGCCGCCGTTCACGGACTACGTATCAACTCGGTGGTACCGAGCACCTGAGCTGTTACTCCGCTCGAC
AATGTACAACAGCCCCATCGACTTGTGGGCCTGCGGGTGCATTTTGGTTGAACTGCTGATCTGTACGCCACTGTTTCCTGGTACATCGGAGGCTGATCAG
TTCTACCGCATCTGCAAGATTCTTGGTACACCTACCAAAGAGACGTGgcctgaaggagcagcaatGGCCTCTCAAATGCAAGTTCGGCTCCCCAAGTGTG
CTCCTGTATCTTGGAAGCGATTTCTTCCTCAAGGAACACCCTCCTCTGCTGTTCAACTGGTACAAGACTTGCTTCAATTCGATCCAAGTCGACGTATTAC
AGCCGCACAGGCCCTTCAACACCGCTTTTTCGAGCAGACCGTGACACGACCGACACTAACAATCCCCCCGTTGGTGATGCCCGAGGAAGAAGTGCCTGTG
CTGCCACTCCGAAGTGAATACAAGTCGGTGGGGGGATACTCGAGCTACACAGGGCGTTCGAATCTGTGTACGAAAAAGTCAGACGAAGTTCCAGTGAGTG
CTGTTGAGGCTTCTGGTCTTTGGGCTGGGGGTGCGCTGACGTCGCGACACGAAAACCATTTGTGGACTGCCAAAGAGAGGCTACAAACGCACACACGGCA
CCAGGAATGGGGCTCTTCACTTGTCAGTGCTCGTCCTGGGGTGTTGGATGATATTAATACTGCTTCGATGCAAAACAGGACAGGCTCATTCACAGGAagc
ttggtgaagaagagctcgagctACAACACGCTAGTgggcgaaggcgacgacaGCTTCTACTCAGCAAGAAAATGTACGCCGGATacgaccagcgaagaag
atgccaaAAGCGACAGCACACTCCTTCAAGACCTACTTGATGAAATTCTAGGCTAAATCATAATAAACTCGCGTTTGGTGATAATTTCATCAGGTATATT
GTTCCTTTCATCGCAGTCCGACGTACGTCATGCAGCTACATAGCAGTAGCCACTTAGAACTTCAGGGCGTGGGCACGGTCGTTCTTGGTCAGAGTGAACT
TGGCGTTCAGGTAGGCCTTGAGGAACGGCTCGGcgtcgagcttcttgatcagAGCCGAGTCAACGGCCTTCTGgtccttcttgcgctgctccgAGATGAC
AGGGGCCTGGAAGGATACGGCAACAAAACGGTAAGTGTCTTATAGGGAGCTTATGTGCCGAAGCAAGCGATCCCAAGCGCTCATGTGGTATGACAGGGGG
CTATGTCCGAAGACGTCAACTTCCCTGCCTGGTCCGCCACGCACCAAAGGGATCGAAACCAGAAAACCAAGAGAGATCCCAGTGGGTTCGTCAATCTCAG
TCCCCAGCGTCACCACTCCGTTGCTTGTTGTGAGCGAACCGTGTGAATTGGTCCTAAAGAACCGACCAACCGGAACGGGATGCTTACAAAGCAAATAGAA
AAGGGGGAAATACGTACGGCGCTCGACTGGGCGAAGAactgctcctccttgctcttcttggcggccttctccttggcgaagTAGGCGTCGTCGATAGCAG
GAAGGGCCAGGCCCTCAACGTTGACCTTGGTCGACGTGGCAATCACGTACGACTGGTTCACGCGACGAAGGGGCACACCGTTGACCTTGTAAGGGCCTGA
ATTGTCACAACAAAGCAAACTGTTAGCAATCGATGCTATCAAGAACAAGTTCCGAGTCTCAACGACAACTAGCCAGCATTCCTCAGGTCTCATAATCTGA
TGGATCTTCGGCGAAAATAAACTCCCTCCCGCCCACAGCAAACCCccaacagcaactgcatGCCACAAACCGACGGCCTCCATTAGAAAACCGTAAACGG
AGTCATTGGAGGGAAGCAGACATGGGGCACCCGTCGTGGAGGTAGGAGCAGACGTGAGGGAGTGGCAGAGCGCCTCTCGAAGTGTCAAGTTTGCATCATC
GGAATGCCTGCTGATTAAACTTGAAGTATCGACTTACcagtgacgagcagcagacccgaagcgagctgcttcaggaACACGACGCGCTTGCCACGGAAGC
GGCCCGAGAGCAGGATGAGAACCGTGCCGGGGGTGATGGACTTGCGCAGCTTGGCGGTCTTCACGCTGTTACGCTTGGTCTTGGCCGAAGGCAGCGGCTT
CGGGATGTAGTCAGCCGGGTACCACTTCTTGGTGGACACCTTCTTGGCAgcgaccttcttctcgccgcCCTTCTTGACCACCTTGCCGCggccgttcttc
ttcgagagGCTGTTGGCGGAGATGGCGTTGATGCCACGGGCAAGGACGACGTTCGCAGTTTTGGCGGGCATGGTGATGAATATACCTATAGAGGAAGAAG
GTTAAGTGGCTGCACGACGAACTGCCAAGGAGCACGACATGACGGTGGACGCTTACCTGTCTGAAAAGAACTGAGCCAGCAAAAGACCTGAACGCCGCAC
GAGAGCTATCCACAGCCAACCACAGAAGATGAGTGTGGTGTACGCAACATTCATTTTGAGGTACAGCGTACCTAAAATAAAGCGGTTCGACGGTTCAATA
GGACCGGTTAATGGTTAGGTGTAGAATGCAGAAATGTGCCGGTACGGTACCGGTTATATTTTTGATTCGGTATTTACGTAATCCATGAGCCATCCGGATC
CGGATAAGCATTTTATGTTGCGCTCAAGTTGCCGAATAAACTATGCAACATTTCCTAACGAGACTTTCTTGAAGCAGGACAGAGAGATCGCACCCTTCTC
CGTGTTGGCACTGGCCTCCGCGCTGCCGACACTCACTGTTGAACGCACCGCGACCTGAACAAGCGTCTCCTAGTGGCATACTGAGAAGAAGTCGGTAAGG
CATGGGCAAGCGTAAGGGACGTTGTGCCACCGCGAACATAACGCAGTCGGACCCTGTGATCGAAAAGACGCAAGAGTTTTCGGCTGGCGGCTGCTGTggc
agcaagagcgacggcgcAGAGACTGTTGCGTCATGCTCCAGtagtgacgaagacgtcaagtTGCCCAAGGCAGAGGGTGAAGCaggaggctgctgctcgt
ctaaagttgaagaggaagtgggcggttgctgctccaagaaagagaagaagaaagagggacgctgcagcaagtctTCAATGTCTGATGAAGCTGTGAACGG
TGTTGTTGGGGTGGACAACTGTTGTTCAACTAAGGATAAACCTAAGGAAtcgtcaagttgctgctcttcaaacGTAGCAGGGTCTTCCGGCGATGccggc
tgctgctccaagaaGTCGCCAGCTTGGACTGGTTGTTCATCGGAAACTGGTGATGCTGTACGTAACGGTGGGAGCTGTAGTGCGAcaaaggacaaggaga
agaattCGGGCTGTTGTTCAAAGGAGCGAATGatcaacaacagcaaagcTGACGATTGTTGTGCCTCCAAAACGGAGCCAAAGACGTCGGGTTGCTGCTC
TAAGAAGTCAGAgatcgaagtcgaagttgacgGTTGCTGTTCTTCTACGAAGGAGTCCAAGAAGGCAggttgctgctcgtcgtccgcaaAGGATACAGGG
AACTCGTCTGGGTCGGGCTGTTGTTCGTCGAAATCCAAGGACTTACTACTTTCTGAGAGATCGCCCAGTTTCTTAAATCGCTTGGTGCAGTTCCGAAGTG
ACCGGGGAGCCTCGCTTGAAAAGCAGCGGGCGCACTTGGGAAGCTCGGggaaaaataaaaacacGAAGGATTCGCTGGAGATCCTCCGCTTGAACATTGG
TGGTATGAcgtgcagtggctgctgtacGCGTATCGAAAAGTTCATGATTTCTCAACGTGGTGTCACGGACGTGAACGTGAGTCTGCTCACAAGTCGCGGA
ATCTTCCAGTTCGACCCGGAGCTGGTGTCGGCGAAGCACATCGAGGAGACTGTGGCCACTTTGGGGTTCGAGCCCAGCGTACTATCGAGCGATGAACTTG
TCAGTGTCATCCTGCATCTCGGCCCGTCGGAGAGTTCCTATCAAGCCAAAAAGTTGTCGCTCGAGATTGCTGGCGTCGTCTCGGCTGAGGATATTGATGA
ACCCATCGTatcttcgacttcctcgGGCAAGTCACTACTAGTGGAGTACAACCCAGACATCGTAGGAGCCCGTAGAATCGTTCGTCAACTCTCCCGCGAG
CTTGGATTCACTGTCCAAGCATCTAGTCCGCGAGCACCGTCGGTTCGTGCtggcgaggaagaagttcgacgCTTTACGCGCCTTTTACTTTGGAGTTGCC
TGCTGTCTCTCCCGGTGATCTTCGTAGAGTTCATCCTGCCAGCGCTTTATCCATTTGCCGACTCCAATCCGGCAGATGCGGGACTTTGGGGCACCGCAAA
CCGGTTGAGTATCCGAGATGCTATCGAGCTGGCATGCGCGACGCCTGTCCTGTTCATCGTGGCGCGCCCCATTCATGAGAGTGCCTTTCTCGCGCTGCGT
TACGGTGGACGCGTTACTATGGACGTGCTTATCTCGCTCAGCGCTTGCACTTCCTACGCGTTTTCAATTTTCACTGTGGTTGCTGGAGCGTTCGCGGAGT
CTCAGATATCAGACGCAGTGCCGACTCAAATGGATCCTTCAGTGGATCttccgcagcagcaagtggagacACCAGCCAAAACGGAAACGTTTTTCCAGGT
CACTGTTCTGCTCGTTACTCTCATTCTTGTTGGCCGCTACATCGAAACGCTGGTAAAGGCGCGTGCCTCGAATAGTGTGGATGCATTGCTTCGTATGCAA
GCCAAGACGGCCATTTTGATGGAAGAGGGCCAGAAAGAGTTGTATATcgacgtggtgctcgtgGAGCGAGGCGATCTGCTGAAAGTTCTTCCTGGTACTC
GGATTCCTACGGACGGTGTGGTTGTCGGAGGTGCAAGTTCTGTGGACGAGTCGATGGTTACGGGTGAAGCTCGCAAAGTGCCCAAAGAGCCTGGAGCAGT
TGTGATCGGCGGGTCTATTAACACGCAAGGTGTTCTATCCATGCGGGTAACCCACACCATTCATGAATCGATGCTGGCACGCATGGTGCGCCTCGTAGGA
GAGGCCCAGGCTTCTCGCGGTGTGCGGCAGAGCATTGCGGATGGTGTGGCTGCCTATTTTACAACGTTCATCATCGTCCTGGCTGGCGTAATGTTCGTGC
TCTGGTATTCTCTCGCTAAGCACGGCAAAGTGGATACGCAAGGCTGGGCTCCTTTCCCGTTCGCGCTGCGCTTTGCGATTACGGTGCTAGTGATTAGTTG
CCCCTGTGCAATTAGCTTGGCCGTGCCGACTGCTGTGATGGTCTCAACAACAAAAGGTTCCCAGGTGGGTATACTTTTCAAGGGCGGTCGCGCTTTGGAG
GCACTCGAGGAGGTGGATGCAGTCGTGTTTGACAAAACGGGTACGCTTACCACTGCAcaacttggcgttgctggGGTCTTCACACCACCGAATGACATGA
ATGAGTTAAAGCTCTGGCAATACGTAGCTGCCGCAGAGAGGGATAGCGAACACTCTATTGGAAAGGCCCTTGTGGCGCACGCTGAGAACCAGATCCAAAG
CactcaagtcgaagaagcgcaaggtTTTGAGGCCGTTCCAGGTTGCGGCGTttactgtactgtacgaGGTGTTGATGTACGCCTTGGCTCACTTACGtgg
ctcaagcagcagacgtaCAGTGACTGTCGCGCACTTCGGATTCCTCACGAGTTTGTCGAAGCAAACACACGTTTCCAGTCCCAAGGCAGCATAGTGGTGT
TCGTTGTAATTGACGGCGAGTTGGTATCTGCGATTGCTCTACGAGATGCACCGCGACAGGAATCAAAGCGTGTAATTGAGCAACTGAAGCGCGATGGAAT
CCAGTCGTGGATTGTTACTGGTGATCAGCGTGGAACGGCAATGAGCGTGGCGAAAACACTGGGCGTACCTGAAGGCTCTGTGCTGGCTGAGAGTCTGCCT
CATCAAAAGGTAGACAAGGTGCGTCTACTGCAAAGTTTGGGTCTGCGTGTTGCTTTTGTTGGAGATGGCGTAAATGACGCCCCAGCGCTTGCTACAGCTG
ATGTTGGAGTTGCactcggagctggaactgACGTGGCGCTCGACGCTGCCGACGTCGTGTTGGTTAAGGATGACCTTCGTGATCTCCTCAACGCCCGCGC
ACTTTCAAATGCCACCAACAGACGTATCAAGCACAATTTCGCGTGGGGATTCATGTACAATCTGCTCCTGATGCCAATTGCTTGTGGAGTGTTGTACGCC
CCTCTAGGGATCTGGATACCTCCGGCCCTCGCTGGGTTGTCGGAGCTTTTATCGTCCGTGCCTGTGATCCTGTTCTCACTGCTGCTAAACCTTTGGAAGC
CACCATTCAGTGGTGACTGGGGTCTGGAGCAAAATCACGTGGCGATCGACGTGACTGAGGCGACACCTCTGTTGCGGAAGCAACGTTAGTGGACGAACAA
GGTAGACTATCGTGCTGGAATTAACTGGTTTGATATTGTTTTATGTGGATTCTTTTTTTCTGCTGTGTGTCCCTAGCTAGAGGTAGAAGCTTTCGCATAC
TCAAGGAACGCTGCTTTCGCGTGCATCCGTGCCGCGTTTGAATCTGCTGACAGTGTCTTGTCATCACTAGGGCTACCGGCGACGATAGCATCgaagcgat
gacgaagtaGCTCGATGTCTTCGCTTGCGGATCCACTATGGTGAGTGTCATCTACTTCACTGTCGGCTACTGAGTCTTGGGCTGCACGCATGCTGCGAGC
GACTTTCACGCCTGAACCACAGGATGGATGCGTTGGCGTCGAGGCAGCTTTGAGTTTTTCTCCAAGTCGACAGTCGTTCACGAAGGCGTCACGACGTGCG
ATGGCTTCCAGTTCAGCTTTCTCTTGCCTCCGTTCTTGtcgttgcttctgctcctcgtccggttcgtcttcatctcgagcAGAACGGGGGTCAggcttca
tcttcagttTGTGGCGGTGATGCAGTGCCTTAAGTGAGAGGCCAAGAAAGAAACAGGCTGATGAACGCGTAGACATTTGCAGGAACTTTGGACGCTCGCT
GCCGAGCGCAAGAAGCACCTCGTTGAGAGCAGCTCCTAGATGCTGCTCCAATTGACCTGGATAGCTCTTAGCAAGTGTCACTTGGGGTGGTAACTTCACT
GGCAAGCTCTGTGAGGTGTATCGAGATGGTTCGGCGCAGAATTTACGACGGGCGTCCTCggaaacgaagaagaagactttGGAACGATATGAAGcgcgga
agaagacgttaCCATGACGAAGTGCAGCCCAATCTTTGGCGCCCGAGCCCGACGCAAATGTGACTGGGCAGTAGCCTTTCATTTCGGGGAAATCGCAGTC
CGGTACAATTAGCAAGCTCACGAGCGAAGCATTGACTGGAGCTCTATCCACAAGTGTCTGTGCCTCgctctctgcttcttcttgcgtcGGCCAGCCCTCG
TCTTCTGGTTGAACTGGAGTTTGATCAGGCAAGTACCCGATGAAGGCTTCAGGGCTCTCCATAAACTGCTGGAGATTTTGTTCATTCCCAagccagaagc
tggagccTCGGAAGTCTACACACAGATCGCGTTTGGATGGACGCGAGTGGTAAAACCTACTCAAACGAAGTTCAACAGGACAGAACGTCTGGAAAGCGTT
GTGCTGACGCGCTTGGAGCTCTCCACGAGTGCGTACCACACCTAACGAGCGAGTAGTTCGATTGGAAGCCATTGCTCTAGTATGGTGCGATGCTAGGCGC
TGTTGCTCGTTAAGGAGCGCTTGGGCTTGCGCAGCTACGTGCCAgagcgagctgcttgagctaTCAAGCTGTCGCACGTGGAAAGTACCGAAGCGTTGGG
TCCAAGTGTGCAATAACTCTAGACGGTAATGGTGCCATCGAGAGAAGGCTGTCCGCAGCTCAGGTCTATCAGTATGAGTCTGATGCTCCTGCCAGACGCC
AGCAAAGTCGCGTTCCAATATGAAGAGCATGTCTGGCTGGATATTTTGCGACCCTGAGTTGAGACTTCGGTGCAGCTCATGATGCTGCAACATATACCCG
TCGAGAACCCAGCCACGCGCCTGGCACTCCGAAGAGCGAAGACGCGTGCAGACAGCTTCATGCGTGACATCTGGGTTGGCGAGAGGGTCGGATTGCTTTT
GTAGCCGAAGGCGCAATGTTGAGCCACCTTGACACTGAATCACCCAGTCTATAGCCGATTGGGGCGAGACGTAGATTAAGCCGAGCGCGTTTGCGAGTTC
CTGAGCCACTCGTGTCTTGCCTGAAAGAGGAGGTCCTAACACACAACAGGTTGGTTGATGTCTCGGTGGAAAACTTGCTGAGTTCAAGTATCTCCACGGA
CAAGAGATGAAAGAACGGCGGGCCTCACGCGATCGTGGAAAGTAAAGCTGATCTCGATGAACAACTGGCGCTACGTCGGTAGCCGATAATGAATCCGTGC
GTCCAGTAACAGGACAAGCGAATCCATGCTTGCCGACAATCAGCTCGCCTGACGCTAGCATCTGATGCATTTTACCCGCCGCTGACATGTCAAGAACCTC
ACAGCGCTCAAATAGCGTCTCTCGGCCTGCCATAAACTCGTCAAGGAGTCGTCTCACGTGTTTGACGACTTGTCTTGGTGCTTTGAAAGCGTCTACCGGG
TTGCAGACCCTGATGCCACGTGCttgaagaccagcaagagCCTCATCCAAAGCTTTTTGGTCCTCGGCAAATTGCTCGTTCAGTCGAGtagtctcttctt
ctcgcgcaACTTCCAAGTCAATAGgttcctctgcttcttcgtcagcttctggaggactatcgtcttcagcttcatcatcgccCCCTCGTTTCCGTGTGAT
GGCAAGTTTTCGTCGAGGAGCTGGCAGAGTTGCAGCCCACCGAGTCATCAAAGTGGCCACGACGTCCTCTTCGGACACTGTTAAAGGCACCACAAGTGTT
GGGAAGAGTCCGTTCCTGAAACACATCTCCAAAGTAGCAGCACTTGGAATTCGAGAGGCCTCTGGTCCCAACCCGGCGATGATCTGTGCTTTGGAAGTAG
TTTGGCAATGAAGCTGGAGTTGAAGCGCTCGTACGAAAATTTCCTCGGAGGTCAAGCGAGTTTCTTCCGCTTTcagttcttccagcagttggTTACGTTC
GGCAATCCCCGCTACTGCAGCCAAGTCCACATTCGCGTACGCTGAGGAAGATTCGATTTGTTCCGTTTGCGTCTGAGCTAGGGCTGTAGCAATCCGACCA
CGCCCAGAACCTCGAACaccgaggagaagcacaCAGGGCACTAAGCTCGCGGTTGCACATGGATTTTGGGGGATGAAGGCGCTTGGATTCCGCTCGAAAG
TACGTTTCTCGGGTTCACCAGCGAAGGCGTAAAATTTTTGCCGGAACAAACAAACGCTTGATGGCAATCCAGGTACCAGCAGGCCACGCGTACGCCAAGA
CACGGGGCAGAAATGTCCACATTCgccttgaagttgcaggGCTCTGATCCTCGCGGCTTCGGCTTGAGCTTCGGCCTCAGGATctgtggcttcttcttcc
tccgttGGCGACTTTATaccttcttcctctttctctgGAACCGGTGAAGCGAATATTGCGACTGGGTCGTATTCATCTACAAGCTCTGGAACATGCCCGT
CTTCGACTCTGTCCACCcgaggagctactggatTCAGTTCTCGTTCAATGGCTGCCAGCGAATCACCCGATTGATGGAATAGCGGGCAAGTTATGACTCG
AGGAGCGCTGCCAAGCCCTAGAACAATTTCCTCCGCGCCAGCCTTTTCAGCTTGGAATTGCTGGCGTCGCAGCACTGATAACGCGCTAACGTTAGTGGCG
TCGGCGTTCGTACTTTCACCCTCTTCCTCTCTGTCCATCAAGAGAATTGTGTCTGGCACGCAACCGTGTTCAAGCAACACAGCGGCGACCTCGCGCGTCA
ATGGCAGATCCGTGATCATCCACCCTGGGGACAGTTTCGACTTGATCGTCTCGGCTACAACTGTTGCAGCTTCAGTATGGGAGACGACCTCTCCGGCCAT
GAGCCTCATTTCCACGGAGATACTTGGTGAAGTCTTGAGTAACTTCGAAGGAGACACTGTCTGTACGTGGAGTCCAGTCGCAAGTGTCTCCAGGTAGGAA
GGTGTGAAGATCTCGCCTGCTCCTGTGGTAACGAGCCAGAAGGTTCGATACGTGGATGGCACTGGGATATCTTGGCGCAAATATTGAAGTGGGTGGGCAC
AGAAGTCTCGCTGAGCGGCTTGAGATGTGAAAAGGTAGACTCGTCCGGAATAACAAACAGCAAACTCCGGTTCGCCGAGTTTCAGTGTGTTAGTTGAAGT
CGACAGCACAGGGCAAAACTCGCGCCATTTTGACAGAAGGCGGCGTTTGACATCACGTTTAGGCAGTCGAGCGAATGACTCTGAGGTGGATCTTGCTTCG
ACCTCAAGAAGCGTACTCCAGTCTCCATACAGCAACCACTTGACTTTTTCGCTACGACTGGAACCAGTTAAATCCTCGGGCAGGGAGATCGGACAAGCTT
CACGCGAGACGCTGAACCGCGACAACCCTAGAGAAGTCTGAATAATTTTGAAAGCACAAGAGTTAGGCGATgattgaagacgaagcaggaAAAGTATTTA
CCCCTGTGATCGCCCGGATGCAGTGGTCTCGGATTACGTTGAGTGATTGAGTTGCCAGAACCACCACCAGGTGATACTCTGGCACGTTGGTTGTTCGATA
AGTGGAGAGTTCGTGCTGCATACGTTCCACATACGCGTGATATCCTTTCGCGAATTTCACCATAGACATTGAGCCTAATGGCAAAGTCGGTTCTCTGGGT
GGTTCGATCTCATTACGTTCTGCGGGTGTTGGTTCCGGTGGAGACACAGGCTTTTCCGTCGGGGTTTGGTCGCTGTCTCcgttctcttcctggtcTACTG
GGGGAGTCTCCaattcctcgtcttcgtttAAAGCGGCCTCACCACTTTCAACAACTACGATAGGCTCTGGCACTGCCTCAGTTTCTTCCTCTGACTTCTT
CGGTGGCAAGAGGAAATCTGCGAAGCCTTGGGCTGCCAACTCCTCGTTACTTGTCGTCTTCAATGTTGCAAGTTCCCGTGCTGAGTACAAACGACCTGCT
ACTGGGGCTAACTCCGCGCCGTGAAGTTGACACTCCAATTCACTGGGTAAAGCTGTGAGAGCCACCAAATAGTCTACTGTTACGCTGTGCTGGACGTCCT
CTGACAATTCGCTCGGGTACACATCGTCCATCACTACCCCGACACCAGCTACAACAAAATATCACAGACACGCCAGTGAGTATCATTTTTCCTTGCTATC
TTGATGTACTTACGCACCAAGTAAAGAGCGAGAGGCTTCTAGTCGTAGTAAAGCAAGTGCTGTGCTTCTAGGAAGGACATTCCCAGTACAAATTGCATTG
AGATCTTCCTCTCGAAAAACACGATCCAtctcttcatccacttccGCATTATTCTCCTCAGATTGTTCGTCTTCTGGTGGTATTTCCATTGGTGGAGGTG
TTTCGGCATttgcatcttcttctgatGGTGTAGCAATAACTGTTCGGTGCCTACGAAGTCGGAGTTTACGGTCGACGGCACGTTGAACGGCTCCGCTGAG
AGATAAATACTTGAGATCAAGACGCCGTGCAAGGACATAAGCAAGCCGCGTCTTACCACTCCCAGGTGGCCCAACAACTGCGACTTTCAGAGCTGGAAAC
TCTGCTAAAGCAGCAACGAGAGCATCTTCAGGGTCCCAATGAGCTGCAGTCTCACGATGAAGTTTTCTTCCTCGAATAGGAGTCGCTCCTGACCCAATAG
AGCCCACAAGTTCCAAATGCAACCGTCTTGCAAGCTCCATATCGTCTTCTACAGCAGTTTTAGCGATATCTGGGGCTTCTGGCGTACCTTCTTCTGTAGC
ATTCGACTTGTTTTTCGGAAATGCACGAGTGAGTGAGAATTTCCGCGGGTTGTAGCTAACAAGAAGCTGTTTGAGCGACATTTCGCGTTGATCCGGAGGT
TGTAATCCTCGAATACTCCGCATAGCATCGCTTGATGGAGGGAGCTTTTGCAGGAACGAATCGTTGGCGATTTTCGGGATCCGATTCAACGGTCTCAACG
TGAATCGGTCAACCGGATCAGCTGAATTGGCCTCATCCTGTTCCGGTTCACTGGATGGACAAATAATCTCCGCGACGGAATGACGTAACGCTCTGAAGAA
AGCCAAATAGACGGTGGCTCCACTCTCCACGGGTAGAACAAGTTCTGCAATCTGCATGACAGCTTCACGGAATTGTTCAGGTGCCATCTCTTCACTGTCG
AAATTTAAGGGTGCTTTGTCGAATTCAGAGCTACGACTGACGCTTTCCAAGTCATATTCCCAGTCCCGTTGCGCTGCGGCAATGGCGATTGCATCGGCTG
ATAATGGCAGGACCAGCGCTTTAGCAGCTCGGGCGAAGAACGCAACGTATTCGTCTCGATTCAGAGTGCAGGAACTCACGGGTTTCGCCAAATCCCAGAG
CAACGTCAATTCTCCAGCTACCAACGCATTCACGTCGCCTCCGTTGGCAGACTCGGCGCCTTCCAGCATGGCATTGCGACGATTGTGCCATAGTTGAAGC
AAATTGGTTTTCCCTTCGCCCACACTGCGCTCCTTTTCGTCTTCGGCGAAGACGAAATGCCTCCGCATGGGGGCTCGGACGCCAGTTCTTAATTGGACTG
ACGGACGGAGCGACTTGGGACGGAAGGTGGTTAGTTGGTTTCGTTTTTCATTCCCCCGTTTATAGGATTCGACACTCACTTATGAGTGCTTATAAGTGTG
TCTTAAGACTTGAGTAGGTAGGTTGTAGTTCACCTCTAAGCTAAACTTCGAGATGTCAAAGTCACACGGGTCGTTTCGAGCGCAATTTCAGCACTGGCAG
TACGGACTCTCGTCTTCTTTCCACTTGtccgctggtgcttcttcatTAACTCCTCacccttcttcttgatcatgTTACCGATGGATTTTCGTCGAGACTG
CTTGGCTGTGACCTCCTGTACCCACGggtgttgaagtgctgctgccactgaaAGCCTCGACTTGGGGTTCACATCGAGAAGACCAGCAAGGAGATCGATA
CACGAAGTTGGCACCTGTGATAGCAGTCCAGTCTCCTGGAGAGCGACCTCCGAGCCACGTTCCACCATTcggttgaagagcttgtcACTGTCAGTCAAGG
CTCGACGCACCAAAGCTCGTTTTGTGCACATAGTCCACAGCATAACACCAAGTGACCAGGCGTCAGCGCTGCGTGCATCCTCGATCTCACTAGAACGTAG
CAGCTCCGGAGCAGCATAAGCTTCTTTAGCGACTTGAAGCACTTGGACGCTTGGCCGGTCGAGCTGGAACCGCTGGGCGTGGCCCAGATCCCCCACCTTC
ACGACACCGGATTCCGAGACGAAAACATTCTCCGGTGACAGATCCAAATGGACGATACCGATCGAGTGCAGCGCCTGTACGCCTCGAAGTACTGCGGTGA
AGACTCGACGTCTACCGGAATCGGTGCAAGTAGTCACCGGAGAGCTCACACCGGCTGCCTGAAGGCGAATTTCTTGCTGCATGATCTCCAGGAGATCTCC
CCCTGCACAGTATtcgtgcagcacgtggaGTCGCTCTCCTTGTAGTGAGTGACGCTCCATCTTGACAACGTTCTCAACGTCAGGAACAGAGAGATGCAGG
TCCAATTCGtgcaatgcagcagcactagcACTACGCCCttccgacgtggacgccgtcATAAGGGTGTGCTTGTCGATGAATAGCCGACCGGAGGCTGAAC
ACTCGACCAGATCCACGCATTGAAGTCCAGAGAGACTTTCCTGTATACGCGAACGCAGCCTCAGAGGAGCTTCTGCCATGGAGTTATCAACTTCGAGAGA
CTGGCACGTATGCGGCGTCTTGGGAAGTGAAGTGAGGCAGGGTGGGGGCTGGCTCGACTTGCTATATTTACCTGTCCAGGTGGATTCCTTGCTTCGTAGT
AACGAACGCAGCGTAGCAACCAATTGATTCAGCAAAGCTCTTCGAGAGCAGAGGGGCGGTGATATGCAATCCAGCTGTATGGCTGCTAAACGCACATGTT
GGGATACGCTCTCTCCCTGCTTGTACTGGTGGGAGATGATCACTAGAGGCTATTAGAATAGAATTGCTTCATCGTACATACACACCGCTATGCAGTTTGA
TGCACGACAAAGGTCCAGGTGGCGTGGTATCCCATAAATGTCATTTACCAACACTCTATTGCCGTCGTGTTGCGGGCTCGAATCACTATGACGTGCGTAT
TGCACACTTCCGTAGTTACACGAGAAATTCATTAGCGGCGTCCACATCTCAAGGTGCCAGTGGTACGTTACCACAGCGTCCAAGGAGGCTTCAGCGATAG
TTTTCAGACATCGGCAGCGTAGGTTGGACAGAACGAGTGGAGTGGATTCTTTCGAGTGTTTTTGGTTGGGTCAATAGTTCGAGTGTTGAGTCAATGTTGA
CCATGTTTGACTGAGATCAACCACGATCGATCGGCTGCCATTTGACGTAGGGCAGCACTGGCAGAATTTGGACAGGAAGCCGTTGTTTACCACTAGATCA
ATAATATCGGAAACTGCACACGGGCGAGTTGCCAGTTGTTGGATCTCTTCTGTCCGTACTTTTGGCACCGATCGAGTCGATCGGACCAACAAGAGCGGAG
GGATACAGGAACCACAGGATatgaagctgttggatgGTGTATCTACTCGTCGACATCCGTACATCTACTGCAGCTTTTACAGTCCGCACCTTCATGGACC
TTGAAGTCGATCGGGCAGCAAACGTTTGGGACTGATAGGCTTCAACGCAGGGAGCTGCCAGTCTCCATGAGAAACATTCATGGCCTCCGTAACTGCTTCC
TAAAGATCGCAACGCAGAAACGGCAGTACTTGCGCCTCGATGACAATGCGTGCGAAGCGAGAACATCTCGACGAGGAGTCGGACGCCGCCGCGCTGGTAC
ACCCAGCTTCGATCGCTAAAGCTGTTGGTGCAGTGCTGGACTACAGTAATTCGTACCTGGGAGATGATAAGTTCGCGGCTATCGCCGAGAAGATCCGCCT
CGCGAACGGCCCAACGCGATTGGATCTGCGTGGCAATTGTTTCGAAGCGGGggctgctcgagctcttgcGGCGTTAATACGGTCCCCCCACAACGTGGTG
GCTATCAGTCTCGAATGGAACAACATCGGTCTTCTCGACCAGGGCGTGGAGGCTCTCGCTGGTGCTTTAGAAGTGGACAAGCGGTTGCTGATCCTCGACT
TacgcaacaacaacattGGACCGGAAGGTGCCAAGGCTCTCGCAAAATCTCTTCGGGTGAATCGCACACTGCGTCAGTTGGATTTGCGTTGGAATGAGAT
CGGGAATCCTGGAGTATTGGCATTTCGAGAAGCTTTGCAGAGCAACCACTCGCTGGTgacactggagctcatgggGAACAACACCAGCTTGAAGCATGtc
gacgagatcgaagcgTTGCTGGCTCGGAATCGAGTGTTTGCAGAGAGACCATCACCGGTTGCTGTCGATGCGTCTTGTCAAAACGATGATGAGGTCGGAT
CCAACAACGGAAGCCCCAAAGCTGCCCCCGATGACCAATTGCTGTTGCAAGTTCTAACGGAaaaggaagagctggagacggaACTCGATTTAGGCAAACG
AGAACGCCGGAAAATGGTGGAGAggacggaagagctcgagatgcagctgcagcaaagcaATAAGGACGCTCAAGTAGCCAAGGAGGAGCGAGATCGTTAT
CAACAACGGGAAATTGACGCAAAACGTGACGTTCACGAGTTGAGAATGCAGCTGGACGAACTCGAAAACCGTAGGAAACTGGAGTTCGAAGAGTACCGAT
CAGCAAGAACAGCTCTCGAGAGGGAGAATGGAGTTATCCGAGAGAAGATGGCTCACATGGAGGCTCTGCGAAACAAGGAAGCAGATGAAAAAGACAAGCA
GATCTCACAGATGGAAGCGGCCAAGTATGCGCTCGACAACGAGCTCCACCGCACGTCTCTCACGTTACGGTAAGTAGACCAGCAGTTCGATCATTCCTCT
ATCACACAAGACTTACTCTTTGCTGAAtagagctcaagaagaagaggttggGAGGCtacagaagcagcttcaagaggCTCAACAGGAGTATACTCGCAAA
GAAAGCAAGTTGTTATCGGAGTATGAAGGCAGCTTGAGCGCCTCCCAGCGACAGCATGATATGGTTCTTGGGTCTTTACAGACGCAGCTCAGCTACACGT
CAACGAACCTCGAAGCGAGCGAGCGAACCGTCCGAGAGCTTAAAGAAAAAGGTGAAGCTTTGCAAgccaaactgctgcagtccCAGATCGACCACGAGAA
ACTCGTTGGTGAtctcaagcagcagtgggAAGCAGACGCGCAGGAGCGTATCCAGCGTTCGGTCGGTTCCGTTGAGGCGCAAGTTGccgaggtgaagaag
gcgcgcCAATGTCTGGAGCGAGAGGTGGAAAAACACCTCGAGACCATTATCCAGGTCCGACAGGATAATGTATCGTTGCAACAGTCGAGAGACGAAAAGC
AGAACGAACTGGAGACCGCATTGGAGACGCAGGTCAAGGCGCTACAGGAAAAGCAGATAcaattggctgcagcagtgagCGAGCGCTCCCGGTGTGAAGa
gaagttgcagctccaggtgcggaagatggaggagcaggaTGACCGACTTGTTCAGATACAGGCAAGCTTCGACGAACGGGTCCAGGTGAGTCTGTCTGTA
GAATATCTTCCCGCGTCGCCTTATACTTACGTATATCGTTGCTAGGTCCTCACCACGAATGCAAAGATCGTGAATGAGGAGAATGCAGTCGTATTGAAGG
AGAAGGCAACGCTCGTAACGTCTCTGGAAAatcaggtgctgcagctggagcgagAGCTGTCGGCGTTGAACCACGAGCATGAAAAGCGCATCGACGACTT
GGCCGAGTCCTTTGGGCGTTTcgtgcaggagcagatcgGCAAGGAGCGAAAACGCCGCAAGAAACCGAGTTCCGACGCGGCGAGGTCCGACGCCTAGTAA
AGCGTAGGCGCCTGTTTGTAGTGACGTGGTGCCGAGTCGGCACCAAATCAAAGCGGCGGAGGACTCGCTCCGGCACCGTCACCATGCAAAATGCAGCTGC
ACGGAGCCCATCGAGGTCTTAAGTAGCGTTTCAAGGCGACAAGTTCTCTGCCAAGAAATAACCGTAACGAAATGATACATGCACGGGGTATTGCTACATC
ATGTCGTGTTCTGGAATGTGACAGGCTTTGCTGATTGGCCGTTTCAAAACTGTGGACTGGCCGAAAATCGAATTTTTGTCGCACCATATGTCGCTGGACG
CATCACGCGCGATCTTTATTCGCGCGCTTGGATTCAAATATGATATCCATCTATTGGCTGAAACAAAGCTGTAAATTATTCCATTGGCGCAAACTCGAAA
CGGCGCCATCAACGGTGTTGAAGCGCCTGCACCAAGCGTTTTATATACCGCAGTCCGGAAAATGCCAGCCCCCGGAGGCTTGCCCGCTTTGCGACGTTGG
CAGCCAACTTGGCTGACACAAGGCCGGCGTTCAGGCAGTACTGGAGAGAAGACCGGAAAGGCCAGCACCCTGGCACGTTTTCAAACGTGTTGACCGCCAC
AAGCCGCCCACCACTTGCGCTTTCACTCCCGAGGGCGTACACGAACGAGATTCTGCTAAGTGGTGCTTAAGCGTATTGACCTAATTGAGAAACGCTTGCA
TCTTAGTCGCGTCACCGAAGTCCAAATCAGTTCACACGCACGATGGACCGCAACATGAGCGTGCAGACGCTTATTAGCCGGTTTGAGTTCATGGCACAGG
CCAACGCCTCATCAGCGGCACCACGCACATGGTCAGTGACGAGAAACACGATTACTGAGCTGCCACCACAGCCAAAATCCGACAACTCGGCAGTGAAGGA
GATCATCACCCGCATCAACACACAGCGCGCTCGCACGCAGTCGGAACCCATGCAAAGGATGCAAAAGCGCGAACAGTctgccaaggagaaggaagaggag
aaaccGGAGACCCCAGTCGCTCAGTTAACCACTCCGACGACGCCTGATGTTTACAAAAGTCTTACAGTGAAAACGTCTCTGCCTGTCGACGAAGATGATG
CCACGACTGTCAACACGTACGAAAACGAGAGCGACGCAGAATCGACCACTACGACCAAGCCCAGGAGCTACTTGACCGTCCCGCGCAGTCCATCAGCCTA
CTCAACTACTTCTACGGGGTCACTGGACTCTCTTCTAAGCTCGTTGGATATGTTCTTGcccgagcttcttctggcgtCGCGTGAAAGCAGTCCCGAGATA
TCCAGGAGTATCAAGCACACAGCATACCATTCGAGACGCTCGTCGCTGCCTGAAACCTTGCAATCTACAAGAACGTCCAAGTTGATTCCGCCAACATCAT
ACCGACGAGCTTCACTTTCGGGAAAGTTATCATCCGCGTCGACGAAACAGACACCAATACCGGCACCCAAGTCGCATCCAAACCAGCCACTGTTTGCACC
TACACCAGCGAGACCCCGTCGCTCTTCTGTATCGGCCACCGCCAAATCAACTCGCCGTTTCTCGGACTCGGCACATAGTCTTCCACCTGTgacttcatct
cctcgtGCGAGAAGCCGATCGAAGTCGTCGAGTGTCCCTCGGTACATGGACTACGACAGTTCTCCGCGCTTCATGGCCACCAAGGCCATGAATATGGAGC
GCCGGCGCCACTTGGAGGAACGCAACCGCAATCTCGCTGCCAACAAGGTTAAACACCTTAGCACCAACGCTACACGGAAGCCACGAACTCCGGAGTGGCA
AGGTCGCCTTGACCAGGTGCGGTCCTGCCTGTttgacgacaaggacgacaacCAAACCGGTTACCAATCGCACGCAGTCAAGGCGAAGAGAGCGGCACCA
CGCAGGCATTCAGCCTCAAGTCACTCTTGTTTCTGAGAGCAATTTGGTGCTTGCGCCCTCCCCTGCGCATACCATCACTGCATGTTTTCGTGCCTACCAC
GCCAGACACGATAACTTATACCATAAAACTATGCATACTTGACGGACTCCGGTCTTGATTTGATATGCGGACGGAATTCctaatgtagccatttattgtc
agagtgatggtccaggacttgaacttcttgatACTGCGTTTCGATTGGCTGAGAGCACGCAAAACGTGTGGTTCCGGTTTCTGACACAAAAACATGAAAG
CAAAGGTCGTGTGAACTtgagccaccaccaccgacATGACAGCCACGTCCGCTGCATCCTTCTCCCCCACGGGCTACAGCCTCGCAGCCAGCTATTACTG
TCTCCATGCAAGCGGCGAAGTTGCCCAACACAACAACATCGTGGAGTCTCCCAAGCCAACCGAGACCAAACCCATTGACGCCACTAAACCCGATGATGTG
CAAGTGCCACGACTGCCACTAAGCGAACTGAATTGGAAGAACCGCGCCCGTttcttggagatgatgcagcgCCATTCGTTTGTGGTGCTCACGGAACTGG
GTGAGAGCCTGGAGCGTACTCACGAccaggtgctgcaggactTCGAGACGTTCTTCACTAGCGGCGATGAGGACTGGAAGAACGGCTGCACTAGCAAGCA
AGTGTACCTCAACGAGGATGGTAAGCCCTTCTGGTACGCTGGATACGAACATACCAGTGTGCGTGACTGCTTCCGTGTGGCCTGCGGGGACATGTCGAGG
CTCATTTGGCCGTCGCCCGACTTTAAGAACCACTGGCTGTCTCTGCAGCGACGCATGCAGCGTATTTGTGACCGGGCTCTGAGTTTGACGGTCGGCTACG
ACGTTGAACCGAGCCACTCTCGCTCAGACAAGGACTTTTCGGTGTGTTACGGACTGCACTACCCCAACATTCAAGGAAGTGGCCAATCCGAGACAGAAAA
TGTTTTCGAGCATGTGGATCCGAGCCTTTACGTCGTGGAACCTGTGCCAAATGTGGAGGGATTGGATGTATACGACCCGCACTCCAAGCAGTGGCTTAAG
GCTGAAAAAGTATGTGTTCCCGGTAAGGAGATTGTGCTCTTCTGTGGTCATGCCTTGAATCGAGCCACTGAAGGTCGCATCCCGGGAACTTTACACCGTG
TTCGTCGTACTCCCGACCGGAGATTTTGCATCATTTACGAGCAAAAGTACGAAGAGTACTTCCTATGACTGCCACAGGATGGAG