Description :
From Genome Similarity Track
Location :
Scaffold_5:92630- 101588
Transcript NameFunction/comments
Physo_128533hypothetical protein
Physo_128534hypothetical protein
Physo_108288hypothetical protein
Physo_128536hypothetical protein

Sequence
8958 bases(100 bases per row)
TGACATGCATTATGCTACAGAGCTAGATTTTCCTGCTGTAAAGTCACGCGTACTTACGAGGTGGCGTGGTTTTTTCTCGAGGATCTGCCGAGCGTAAGCT
GACAGATCATATCACGAAAATGTGGGTGAACTCCAAACGTTTTTCACGTTGGCAGTCCTTTTACAGCCCGAGTGGATATGCCGCTACTAACAATCCGTTG
GAGCAATACCACAAAAAGGTGAAAATGCAGTGTCCGGATGGATTGGCTATTCCCAGTGAATTGATTCACAACTTGAACCGTGCCCAGCTGGCGTTTTTGT
ACCAAGATACGCATTTCAGCACAATGGCGGAAGCTTCTGATCGATTGATGCATCTGTATCGATTTATGTACAGGCGAGGGCGTCTTTCGGTGCGCCGCAT
ACCTCAGGTGGGGGATTTGCAGGCCGACCTGTACCGTGTATAGTAACGCCCGCTCCGCCTTAGCCCAGCAGAAAAGAAGAACTCTATCAAATCTGTTAAT
GCGCGGCGGATGCAGACTGAGGGAATGCTTCCAGGCGGCTGGGTGGTTGACACATGTGCCTACAGTAGGAAACACGCCCTCTGTGTGCATGTTGAGGCAG
CCTGCATTTATGGTGGCGTGCACTGTCCCGGGGTCAGTGCAGGGACTCGGCAATTTGTAAGGCCTTCGCACAGAGATGCGGAGGACCCCTTTTCTTCATC
CTCCGATGAATCTTTGGTTGATTTCACGTATCCGAGTCGATCCCCATCAACTGCTGCTGATGGTAATCACGCCTGGTTTCCAGGTGGCACTGCCATAGAG
GCAGCAGATGTTGCCCTACCTGTACCAGAGACGCAGTATGAACCCACTAGTCCAGCAGCTTCTACCACGTCCACTCTCATTCTAGAATATGACGAGGACG
AAGCCACCGCCACATCCGTGCCAGACGATTCTGTCCGGCGGTTGGAGGGGAGTTGTTCTTCAAGGGAGGTTAGTTGTTGTTGTTGTTTGGGGGGCGTCGA
CTACTTGCACTCCTTCGGGTTCATCTTCATCTTCATCCCTCGTACAGGTTGGATGAGGGGCCACACTCGCCTTTATAATGGTAGACGTAGTGTAAAGTGT
AGAATGATAATGTTTAAAGATGCAGTTACGAGAACAGTATGAAGCTACACTTACATTGGGCGGCACGAGACTGTCATTTGAGTGGCGCTCCCTGTTTTGG
TGAATGGACACTCTCTATCGGTATAGTGTGTGCTTAACTACGGTTTTGTTGGTGTCGTTTATTCTAAGTTTGGTGGAGACTTCTGGTTCTTTGGTGGTGG
TACAGCGAAGTTTGCGAAGCGTCGTTCCGAATGTTCGCGGAGCTCCTCGACCTCAGCCTGCACCTCGTGGCGAACGATGTCTTCGACAGCGTACCACTGC
GCAGAAGGACGCGGAGGAAGTCCCAAAGGGCTCACTGATCAGTTCAGGTTACTTCTACGTGAACGACATCTTCTAGCGTTCCACTAACGCCGATGGTACA
TTGGAGTGTGGAGCGGACCTAGACTCGTAGGTGATCGCTGGCCAACCCTGATGCGGACTCGCTAGTCATGTTAGTAAGACCTGCGCCAAAATATCAAAAC
ATGCTGTTTTGTAAGCGCTCACACTTACCGGTATATCTACGCAATCCGCAGCTTCGCAGCCGCAGAATCTGCCCGGCAATGTAACACCACTATGCGCACG
ACGAACAGACAATTTTAGAGCAAAATCAATAAAACGAATCTTGACTCGACGAATTTGCAAATGAACTGGATCAGCCTCCATCATTCTTGGGAAGTCGAGA
ACACTCGGTCAATTGACATCACTTACTGTAAACATGTTACCGGCTCATCACCGGTTCCAATTGGACGGGGGACGCCCGAATTAATCCTGTTTGGGCTGGG
CTATCAGCACTTCGCCAGTAAAATCTATTTTAATAGTGTTAAAACGATCCAGATAATGGTCTGGGGCTATTTAACGGCCCAAAACAAATTTTGAACGTGT
TTTATCTTTCGAATTAAAAAAAATTACATTTTAGTTAGTGTGTTTTAACATTAAATGCTATTACAGTTGTCGTCAATCGAAAGGGCAGTATTGTCCGATC
GTCGGTCACCCGGAGGATGTGTGCAAGTCTCGACCCCGAGCGGTAGGAAGGCAACGCTAGGGACCCACTTCAAGCGCTCGTTATGCGGCTTCCGCTGCCC
ACGGACTTCTTCGCACCCGTGCGTCTGTGTCCATCTGAGGTGCGCGACCTGCAGCAGGTGGAGGCGCGCCTGCTAGCCGCGTACCTGGCCAGCTATGACG
CGCACGCAGACGCAGACGGCGCTGACGCCTGGAAGCTCGTGGGGCAGCGCGCGGGCGTCAAGATCTTCAGCCAGCGGCGGGGCAAGAAGAAGAGGAAGAG
CAGGCGGTACCAGCCAGAGCCTGAGTCAGAGCCCGAGCCCAGAAGCCGCCGCTCAAGGGGCGAGGAGCGCGAGCTGCCAGCGCTGAGACTCGTCGGCAGC
GTGGACGGCACGCTGGAGGACGTTCTGTACGGGGCCATGTGGCGCTCCGGTCGTGAGCGCGCTGCCAGGGCGCATTTCACCGGCGACGCCGTGGCTGACG
GCGCCGTGCTGTGCTCGGTGGAGGCGCCGTCCACTGCGGATCCCTTCAGGTCGCTTAGTGTCAAGTGGGCGCTGAAACGCGCGCCTCATGGCGGCCTGGT
GGTCAAGGACCGGGACTTCTGCTACCTGGCGTCCATGGGCGTCGTGCACTCGCCGAGGACGGGCGTGAAGCTGGGCTACAGGCTGCGCCACTCCATCACG
TTCCCGTCCTGCCCGCCGTTCCAGAATCACTCGGTGGTCCGGGGCCAGATCTTCTTGTGCTCCTTCTTCCGGCAGCTACGCAATGGGAGGGTGGAGGTGT
TCCATGAAGGGACCTACGATGTCGGCGGGGGCAACGGCACCATTGGACTGGGGCTGCCCAAGTCCATTGCGGAGAAGAGCATTGTAGAGACGCTGTTGGC
ACTGGCGGACGTTAGATCCTGCGCGCTGGCCAAAAAGCTGGCTCGCGCTGTGGAGAACACGGAGGCGGAGCGCGCGCTTGCCTCGCTGTCATCCACTTCA
GTACAGGAGTCGTTGGATGGAGAGAGGCGCTGTGGAATGTGTTTGCGCCGCCTGGGCAGTGCTCTCAAGCGCCACTGCGCGGCGTGCCACCAGTGGACAT
GCTCTCAGTGCAGTGTACGGCAGGAAACTGTACCGTCAGCTAGGGTCACGTGGGCCGCGGGGCCTGTATCAGCGCGCTGCTTCTGCAAGGCTTGTGTAGC
GAAAATCCTCCACGAAGAGGCCACGCAGTACGCGGCTCGGGACGCAAGCGGGAACGACTACGAGGTGACAAGTGGGCGGTGGGGTCATGACGATATTCCA
GAGGAAGAGGAAGACGAGGAGGAGCTGGTGCGTCTGCCGGGTCGCCGACACTCGATGGTGTCGCTGACAGCAGACACGAGACGTTCGTCGATGGAGGAGC
TACCCCGACAGCACAGACTCATGACCGTGGCGACGACTTTCCCCAGTAGCAACGAGTACGGCCCTCGCACTTCGGTGTCTCGCTTATCTGCCAAGCAAAT
GTCCGTGGAAAGCGAAGCCATGAACACGGTCAACAGCTCGCCCCCTGACATCCGCCGTCGGCGTAGCGCTACGCTGGCTGCGGTGCCTACCTCACCGGAC
GGACGGCAGCAGCTCAACAGCAGTCAATCTCGTCGTCGACCGAGCATGAATGCTCCTGATATCCTGCTACGTAGCGATGTTGGGAGGCGGAATTGGGCGT
CTTCGACCTCGGCGCTGTCTCTTCAATCACCGCAGCGACACATCGATGGCTCGCCGGTTGTGAACATTACTCGGCGCCGGCGGTCAGGAAGTGTGTCGCC
TTCGGTGCGCCGAGTCAGCTTCGGCAGCAGCTGCAGCTCGGGCGGCAAGAGTGACGAAGTGCGCGTGCGGATCATCACGCCCAAGCGGAGCCAGCCGGCC
GCTGCGTACACGCCGTACTTTGCGTCGGCGGGGGTGTCGTCGCGAAGGGAATCCGACCCGCCGTCGATTCGGACGGTGCACAACCGATTCTTCCGGGAAC
TCTACAGCGACCGAGGGCGGAATGGAAATTAGAGGGGCTGCGGTCCGTGGTAAACGCAGCCAGGATCGGTGCCAAGTGTACAAAGTCTTTTAACGCTAAA
GAATTCATAGTTTTGTAATGCATCGAGCACAACACCGTTTGAGGACAAGCCCAAGGGTGGAATGGTCACCCGTCAGCGTCAGTCATTTTCTCAAGAGCAA
CGTTTCCTCCCAACGCAAGCACGTGCTCGGTTCTCAGATCGTTGCGAGCGTACATCTGGTACTGTGCAGCAACGGCCGCAAGGAGAGCAGCACAGCAGCG
TTCCGGTACTGTAGCTAGTGAAGTCGCTGCAGTAGTCGCCGCCATTACTCACTTTTTATCGCGCAGCCAGGCCTGTTCGAGAGAACGCAGCTCAGCTCAG
CTTCTTGCGCGAGAGCTACTAAAGGTAACCGCAGACGTGCGGTTGTGTGTTTGTGCGAGCCTCAGAGCTGAGCCCACTGTGGCTCTCGTTGCAGCTTTGT
TGCGCGCCGAACGACGCGAGTAACGGGTGCGCCCTGTGATTGGCTGGCCGGCTTCAACTTGGGGATCCGTTATCAGACCCTCATCGCCTGTCGACCAACA
TGCCTGTCGTTCGACCACGCACGCGGCACCGCTGGACGCTCGCCCTCCTCCACCGCTGCCGTTGCCGTAGCCGTTGCCGTAGCACTCTGATCTCCTCCTT
CACTTGGGCTCATTCCGGAACTTCCTCCGTCCAAGCGAGCCTCCCTCCTCCCCACCCTCATCCGCCGGGTACCTTTCCACTTCCAGCTCCATCCGCCAGC
ATGCAGACCTCCACATTCGCGCTCCTCTCCATCGCTGGTGCCGCCACCGCTGCCGTGTACGCCACGGAGCCGTGCAACATGGGCACCATCCAGGGCAGCC
TGCTGCCGAACGGCACGGCCTGGCACAAAAGCTGCTTGGCCGCCACGGGCATCGACGTGTTCAAACTGGACTTGCTCCCCACTGAAGCTCAGGCCGAGGA
CCTTTCACAGTCGCGCGACTGCGTCAACTACATCAACCAGATCAACCAGAAGGCCAACTCGGCCATCCAGTGCGAGACGACCGTGGGCGACCAGACCGTC
GTCCTCGGCGAGCTGCTCACGGAGTTTCTCAAGGGCAAGACGGGCAACACGACCAAGGAGGCCGTGGTCGGCTCGGACAGCATGTCCGGCAGCGTCTCGC
TCTCCAGCAGCAACTCCACCTCAGGCAGCAGCAGCGAGTCAGCTTCCTCCAGCGAGTCCGCGTCCGGCAGCGACGAGAGCAGCTCGGGCTCGGAGTCCGC
CGCCAGCGCCGAGAAGCAGGTGAGCAGCAGCAGTAGCAGCAGCAAGAGCGCAGCTAAGTCCGGCAGCAGCACCGTCACCGCCGCCACCTTCTCGGTCATC
GCGACCGCAGCGACCGCCGTGCTCGCCTTTGCGCTGTAAGCTAGACCACCCAACGCAACGTCCGTACGTGCACTTACCTTTGCCAAATAGAATTTTGAGC
GTTGAAGCTTGCTTCGTTTGCATCACTTATACGATCCATTCAGCTGCTTGCACCTGCCAGCTTGACACGTGTGGATGGATATCAGCATCGAAAGCAAGGA
TAATCTACCGCGTTTACTGCGTGCCGACATATTGTGGAGATCGCCCTCGTGACGCTGCTGCAGCCACGAAGACGCGATGGGCATCTCGCCAGACGGCGGC
AACGCGGATATGCTCGGATAAGACCGCACAGCGCAACGCCAGCAACATCCTTTGTCAACATACACACAGTTGCATGGCTTTCAGTGAGTCTTCTGGCCAT
GCGAAGATGCGCAGCTTGGCCTCCTCGCCACCTCGCTCATGGATATAAAAGCGAAGCAAGCGCAGCTACAGCAACTAGCTGGCAGTCCACCCACAGGATG
CGTTCAGCTGTTCGACTACACGAAAGAAAGCGCGGGTTCCAGCTATCCGAAAACGGCTAGCGACTTATCGAACAAGCGGTTTCGCTGGTGCAGAACTGAA
GAGCTCACCTAGCCTGCCTGCTTCCATGGGCACCGTCTTCGAGCTCTATGCAGCTCGAGTGTGACAGCCCTTCGCACATACACTCACAGCTCGCCTTCTT
CCGAGCGTGAAAGGCGTTCGTCGCGTCCTCCTTCCCCTGTCTATGCCGAGTCGACGGTAGTCAGAGCGCGGGACATCTTCATCTTACCCTGCTCGCCGTG
TGCAACCGCCTCTACTCGTTGAAACTCCACGAGGAGCGCACCATACGGCGTCGGGGCTTGGGTGCCGTCCTCTCTGCGCCTTTGCGCCGCAACGGCAGAG
ATTGCGACCGACGACTGACGGCGACTGCAAGGCAAGGCGTCGCCTTCCACGCTTCTCACTCTCCAATTCACCAGCCCCGAGCACTCGACCAAACTCCTTC
CACCCCTCCTCAACGTCCAAGATGAAGACCGCCTGCCTGTCCGCTCTTGCCCTCGCCGGCGCCATCGCCTACTCGAGCGCCGCCGACTGTGACATGGCCA
AGATCGAGGGCATGCTCTACCCGAACGCCTCGGCCGGCCTGGCCAGCTGCGAGAACGCCACGGGCATCGACATCTTCGCCGTCGGCACGTTCCCTACCAC
GGAGCAGGTCACGCAGCTCTCGCAGAACGTCGACTGCGCCGACTACCTCAACCAGATCAACCAGGTGGCCAACTCGGAGATCCAGTGCAACGTGACCATC
GAGGGCGTGCCCGTCAGCTTCGGCAAGCTCATCGCCGACTTCCTCACCGGCAAGACTGGCAACGAGTCCGACTCGGGCAGCGGCTCGATCGAGATCCCGA
GCGCCAGCGCCTCCGGGTCGGTCGAGTCGGGCTCGGCCAACCTCGACAGCTCGGCTACCAGCTCCGGCTCGGCCGCGTCGTCTAAGTCAACGGGCAGCAG
TGGAGCTGCTGGTGCTCATGCGCTCTCGTTCGTCGGTTACTGCGTTGCTGGCGCCATCGCCCTGGCACTGCATTAAGGGGTGCTCGATGAGGTGTGATAG
AGTTATCGTAGTGCCTCGGGTTGCGAGCACTTTGTATTCTTTTCTTTAGCAACAAGCTTTTAGTTTTGAGATTTCAGTGTCGTAGCGTTTAGCTGAGTTG
TAAATGCTAGTAGCGTTCTCTGTTTCGTCCTGTCTAAAAAAACTCGATGCGGTACCCGCTGCAATACCCCATCCCAAGCCCACCACGACGAACGTGGTCG
ACCCACAAGATGATGAGGCCATGACGACCGGGCGTCGTTGCTGTCGCCTCCCTCGACCCCATGCGCGCACATTTTGGCGACTCGACCATCGCCAATGAAT
TGGCACCAGCCGCAGACATGGGCGATGTTGTCATGGGGATCAATATCACGGCGTTTCCTACGAGGAAGAGTGCGTTGAAGTTCCAGCAGAGCAACGACTG
TGCCAGCACGATTAACATTGTCCTCGGCTTCCCACACCCAGTGCGCGATCACGGTGAAGGCACCGAGGTGATCTATCGAAAGCTAGTCTGCGGCTTCCTA
GGTGACTCCAGCAGCGGCACAGTTGATGTCCCGAACGAGGGTGCGAGTAGCGCAGGAGCAGGAAGCAGAGGCAGCTTCGGTTCATTCGCGACGGCGGTTT
ATTATGAACCGCAGGACTCAGAAGACTTGCGCGAAGTTTCGAGGCTATGCACGACTGGTGGTGTTTGTCGCTACCGGTTGGCGTCCTTTTCCGAGCTAGC
TTCGGTCAACTGTACGCTCCTTGGGCGACCAACTCGTCCACTGGCAACTCGGGGGAGAATGCTCTCCGCCCAGCGTCACTGGTTGCATTTGATCGGCAGT
GCCGCCGACTTGCCGATCGCTGCACGTGTGCCACGAGTTACTAGCGGTGACACGCCATTTTCAGCCAAGAGCGACTTGAAAGTCTTTTGCAGGTTCTTGA
AGGCGCCTTGAGCGCATATTGCCCACTATGAATAGCAACTCCAACCTCAACTTGCTCGTCGCGCTTTCTAGTGTCTTCGTGTTTCAAGCTTTCGGTGCTG
CAGTCTCGAAGCCCAAGTTTAGCTTCGGCTGTTGAAGACGAGCGAGTTACATGAGCGATAAGGACCCTGTGGCCACCCGTTGAAGATGGCAGCGCCGTCG
CATTTCCAGAACGTTGGCCTCGAGTCTTACCATCACAGCTAGCCAGCCAGGAATACACGGAAGCGCTACCCCCTCTGGCCCTCACATTCCAATTTCACAG
CTTTCCAACAAGCCAAGTTCCGACTCACGTCCCGCCTCACCAAGACCATGAAGGCCGTCATTCTTTCCGCCCTCGCTCTCGCTGGTGCCATCCATGTTGC
CTCCACTATGGATACCTGCGACTTGGCGGCCATTAAGACGACTCTCATGGGCAACGAAACAATCGCCGACAAATTGACGACTGCCGCAGACAAGTGCGAG
GCGGACACTGGTGTCGATATCTTTGCCATCGAGGGGTTCCCGACGAAGGAGACGGCATTGGAGTTCCAGCAGAGCAACGATGGCTGCAACGTCGCCATCA
ACATCGTCACAAGCCAGGCCAACATCAACACGCGGTGCCACATCGATGTGAACGGCACAATGGTGATCTACGGCGACCTCGTCAGCGACTTCCTCACGGG
CAAGACGGGCAACGAGTCCGAGTCCGACAGCGCCTCCGAATCCTTGAGCGAGAGCGCTTCCGGCTCCGAGTCCGAGTCCGAATCCGGCAGCAGCAGCACC
GCCTCGTCCAACTCGACCTCCACATCGGATGCTCCCACGACTACGTTGTCTTTGGTGATGTACGGCGCTGTTGCCGGAATTGCCATTGCGCTGCGCTAGG
TCAATCACCTGGTGATAATACTCGGGCACGCACGTAACTACATCTGCCAGAACTCTAA