Description :
From Genome Similarity Track
Location :
contig_66:92622- 94071
Transcript NameFunction/comments
g11819.t1hypothetical protein

Sequence
1449 bases(100 bases per row)
TCGTGGACGGCCGTGTAGTTGTAGTACACCTCGTTCTCGTACTCGCTGTCGCAGTACGGGAACGGCACGTCCGAGGTGGTCGGCGCGAACAGTTCCTTGC
CAGACGTGTACGTTACGTAGCAGCCGAGGAAGCTGCAGATGACGACAACTAATAACGCAGGGACTTTCTCCCACATCGGGATTTCGTTCCAAAGCTTCGT
GAGCAGGAAGATAATGGGCAACAAAATGCTGATCAGCGTGATACACGAAGCGCCAACGAAATCCAAAAAGTCGGAAAAATGGTCGCGGAAGATGATCGAG
ATAACCACCAGGATCACCAGGATAACGACACGGAGGATAACGTACTTGATCGCGTTTGCGCCACGGTATTCGGCAGCCTCTGCCTCAATGTCGTCAAGGT
ACGGGTTTTCGGCGTCAGCGTTTGAGATGTACGACATCTTGGACGAGAGGCGGCCGTCGCTGTCCTTACTGGGCGTGTTTGCTGCGCCGTACATCAGAGC
ATTTTCCACATCATCTTCCTTCTTTTGGTGCATCTTGAGAATCAGGCGCTCGGCAAGGTAGAATGGCGGGTTCAGAATGACGGAGAAGGCGATCGTAATG
TGCAGCTGCATGAAAAAGTAGGCCATGACGACGGCGCCCCAGTTCGACTTGAAGCCCAGCGTGGTGAGGCCGCTCGTCGAGTCCGGGTAGATGGAGAACA
AGATGTTGCCCGTGATCTGGCAACCCACGGCCGAGTACGCCGTGCTGGCCAGGATCAGGAACAGGCACGAGATGAAGCCCATGGTGACAAACACCACGCG
GGGCATGCGTGTCGGCTCACGGTGCTGGCGCTGTAGGGCCGGAATTACAATACCCGCGTTGTACGCGACTGCCAGGTTGCCGAACATGCCCACGACCTGC
GAGAACTTGATATCGGGCGACGGCGCAGACGGGTGGCCGCGCATGCAGTACATGACGACGGCTACGCCAATAACATCGGCGATGATCGTGCCCGCGCAAC
CAGCGAAAGCGACCCCAGCACCTTCCTTGAGCGTCGGGATGAGGCAAACGGGCAGGCACAGGAGCGCCATGAAGCAGATCCAGTAGGTGGTGCTGAAGGC
ATCCGGGAAGAGGCCGTCGAGCAAGGTGCCGCCCAGCACAAGTAGCACACACGGGCCTAGCAGACACGAGGCCATTTGCGAAACGACTGCAACCAGTGTC
CCCACTTGCCCATGCACCACTCGCCTAGGTCGCTGTAGGTCTTGACACTCTTAGGTGCCAACAGCATGACGCGGCAGATGGCAACGGAGGAGTAGACGTT
GGCGAAGGCCATGAACGCTAGACCGACGATCCCTAGCACGGGGCCAGCGCGTGAGAAGTTGCCAGGCATGCCAAGTGTACCAATGCCGTAGACGCAGCAG
AAGATGTTTAGAGCGATCTTGAGGTCCTCCGTCGTAAAGAACCTTTTGC