Description :
From Genome Similarity Track
Location :
Scaffold_350:9262- 13188
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_350-snap-gene-0.13Dicarboxylate/amino acid:cation
Pytar_ATCC12531maker-par_contig_350-fgenesh-gene-0.1Dicarboxylate/amino acid:cation

Sequence
3926 bases(100 bases per row)
ACAGGACAAGCACGACAGGCGGGCGTGAGTCTTCTTGACCTTCAAAAACGCATGCATTACATCCTACCATCATTCTTGAAACAAATTTATCAAATCTAGG
TGAGACCGCGGGAAAAAATACCAATATACGTCATGTTGGGTATGATCAGAAGCAGAACAAGGTAAAGTTGATTGGATACGTATCAGAAAAAGGTGAACTA
CTGAATGAAGGGGCCATTTAGCACGCTGTCTCATGGTGGACAGTCTCAAAGGCCTCGTCGACGTGCTCGGCAATGATGCGCGCGACGTACGTGTCACCGA
CAACGTTGCAGGCGGTATTAACGCGGTCGAGGTACCAGTAGATTGCGACGAGGAACGAGTAGGACGCCGGCATGTCAAAGTTCGGGAAGATCGTGGACCA
GATTGAGTAGATCATGATGAGCCCGCCGTTCGGGATGGGGGCGACGCCCAGTGAGCTCAGCAGCGACACGAGCACGATCAGCGAGAGCTGCACCCAGCCG
AGCTCGATATCCGCGGACGCCGTGGTCGCGAGAAAGACCATGGCATTGGGGAACAGCATGGCCGTGCCGTTCATGTGCACGCTCGAGCCAATGGTCACGA
CAAAGCGCAGCAGGCTCTTCGAGACTTCACGCGTCGACTCAACGCAGCGCAGCGTCACAGGCAGAGACGCAATCGATGACGCGCTACCGAAGCCAAAGTA
CACACAGGGCAGCATCTGCCGCATGTATTTGTACGGATTGCGGCGCGTCGCCATCCAGAGCACGACCGGGTAGAAGGCAAGTTCGAAAATCATGACCGAA
ATGAAGTTGCTCAGCACGAGCACACCGACGTTCCTCATGGCCGCCGATAGCGAATCCTGGCTCGAGAGCGAGCCGGNNNNNNNNNNCGCGAGCTCGAAAA
CTATGACCGATATAAAGTTGCTGAGGACAAGCACACCGACGTGCCTCATGGCCGCCGAGAGCGAGTCCTGGCTCGAGAGCGAGCCGGCGATCAGCGACAG
CACGGCGACTGGGCTCCAGTCGATGAGCTTGGAGATGACAAAGAAGAAGATCTTGTTGATCTGGTTGAGCAGCTCCAGCAGCGGACTGCTTTGCTGCGAG
CTCGCTCGCATGGCCGCCGCGCCAAATGCNNNNNNNNNNTAGCTCCAGCAGCGGACTACTCTGCTGCGGGCTCGCCTGCATGGCTGCGGCGCCAAATGCA
ATGGAAAACATGATGACGCTCAGCAGCACGCCGTCTTCAAAGGTCTTGAAGATGTTTCTCGGGAAGACCGACTGGATGATTTGCGTGAACTGCTGCGCGA
TACTGACGTGCGTGACGGGCCCGGACGCGATGATGGCATGCGAGAGATCGATCAACTCGAACCGCGTGAGTTCGCTCATGGTCGTGGCCGTGCAGTCCAT
CGACCCATTGCCGGCGATCAAGTACCTTCCAGGCGCGCACTGAACGTGCATGAAGCCCTGCACTTTGGGTGGCGGGTCAAAATGCGTATGTGGGTTGAGC
GGGCGCAGAGACATGGACACGGCGAGCGAGAGCGTCGACGCGATGCCCGAAAAGAGCAGAAAGAAGAACGCCGTGCGTGTGCCGACCGCCGAGACCTTGC
CCAGTAGCACAATGCTCGCGACGCCAGTGGAGAGACTGCAAAACACCATGGGGATCACAAAGCACTTGAGCAGCCGCAGGAAGATCTTGCCCGGCAAGTT
GACGAGGTCGCTCACGGCGGTCGAGACGCTGATGTGGGAGAGCCAGATACCGAGCGCCGTGCCAAGCACAACCGCAATGCCGATCTGCGGGTTGGTTTGG
CGCAGGAACGACCACCGCGAGTCGCTACCGTCGCCTGGGTACATGTTGCCTTCCTCGTGGCGCCACGCCTGCATGGTCGTCGTGTTGCCGCCTTTTTCAA
AGCCGCTCTTGCGCGCATAGGTTGGCTGCTGGTAGTAGATTGCCGGCGACGCGATCGAATCTAGCGGCGTGATCGGATCGTCGGAACTGAAGAGCCGGCG
CTGGTCGGTCTCGTCAAGCAGCACCACGCCGGGCTTGTCTCCCCCATACGGCATGTTGATCGCTTTGCTCTCGGAATGCAACGTTAAGTTGTGAGACCGT
GGAACTGTCCGTCTGAGGAAGGACGAGAACACGGGAATGAGAGGCACCCAAGTGAGGCTCAAAGCGCAGAGAGCAGACGGCAGGGCGCAACTGCAGCACG
CAAGACCAGATCAGACCAGACACCCTGGAGGTTTCAGCTCGCCACGGACATGTGGTAGTGGAGCTATTCATACACAGCCAAGAGCTCTCTGTGACGTGTG
AGATGACCCATTTGCCTCTCCCGTTCTTCGCTATCTTTGGGGAGCCAGCGAAAGCCCGTCCTGGGGCTTTCAGGACGGACCAGAGGCGAGTTGCAGGGCT
GAGTCCCACCGGTACTCAGCTCTGTCGATTTGTCTCGCTTTGATTACGCCGAGCTGTTCCACTCGAAGGTGAAGCCATTCGCGGTGCGTCCACGTCATTG
GCTCCTCTGATGGTGTGACTGGTGTGAATCCAACAAAAGTTGTAAAACAGGGTATACTCAAACCAGTATAAAGTACCGAATCTGTTTAAAACACGGATGA
TGGCTTTCCAACATGTTCTCACGGCCGTCACCTCATCCAAAGTGTCCCTCCACGCCCACCGCCCACTTCGCGATCCTCGGGCTCGTCGGTCCCCCCGCCC
CCTCACTCCGTCTCCGTCCTCCTCCTTCTCACCTCCTCCTCCCCTCCTCCTCCTCTCTCCACCCGAGCATGCCGTGCTACCTGACGTCGTGCGATCCGGC
GGAGGAGGCCAAGCGCTTCGGCGCCGCGCTCGTCGGCATCTACGCGTACCACTTTGTATGGGACAAGCTGCTCATCACGCCGCTCGTGAATTGGTTCGTG
CGGCGCCAAATGATCACCAAGGACAAGCGCGACAAGATGCGCGAGTCTCTCTGGAAGAACGCGTCGGTCGGGTCGTTCACGGCGCTGGGACTCTACATTG
CGGCCGACAAGGACTGGTGGATGAACCCGCACGGGTACTTTAAGGAGTGGCCGTCGCCCACGCCCGAGCCCATCCGCTGGCACTATATGATCTACATTGC
GTTCTGGCTCCAGTCGGTCGACTTTATGCTCAACTTGACCAACAAGCACTACATTGTCAAGCGCAAGGACAATGCCGAGATGCTGCTCCACCACTTTGCG
ACCATCACGCTCATGGTCTTCTCGTACGTTTTCGACATTACGCGAGTCGGGCTCTGCGTGCTCATGATCCACGAGGTCAACGATCTGCTGCTCGAGACTG
GTACGTGCCCATGCCATGTGAGACTTTCGTGTAGATTTGATGTGCTGAGATATCTCGTGGATGATCCCCTGCCCAACAGCCAAGGTCTTTGTGTACCTCG
AGTGGGAGTTGCTGGCCAACATTTTCTTTGGCACGTTTGCACTCGTGTGGTTTCTCGTGCGCTGGGCCGTCTTCGGGTACAACATTCTCTGGTCGGTCTA
CACGATCGCCTTTGACGACATCATCGTGCCGATCCAGCAGAAGGGATCGTACATGGGCATGCCGGCGAATACGTGGTGGTGGTTCTGGTGCATCTTCCTC
GTGTTCCTCGGCATCCTCTTCCTGCTCCACATCTTCTGGGGCGTGCTCATCGTCAAGATGGTCGCCAAGACGCTCCAGGACGGCAATGTCGAGAAGGACA
TTCGCAGCGATTCCGAGGACGACGGCAAGGACAACGAGAAGAAAGTGGTCGAGCCCTCCAAGCCCACACCGGCAGCGACGGCGACGACCAATGGCGACGC
CAAGCCCAAGCCGCGCCGCCGTACCCCCAAGGCCGAGTAGACACCGCTACGCGAGTATGTATGCGTTGTGCATTTTGCGAATAGATCTCGTGAGATCCAG
ATCGGAGTATCTGATCCCGCCATCTG