Description :
From Genome Similarity Track
Location :
Scaffold_7:926163- 929463
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05314phosphatidylinositol-4-phosphate-5-kinase (Pi-PIPKD10)
Phypa_INRA-310PPTG_05315alpha,alpha-trehalose-phosphate synthase [UDP-forming]

Sequence
3300 bases(100 bases per row)
TTGTCACGTGGCTCCTCCACAACTCGAATCGTCGAGTTTCTCATCTCACGGAGAATCGGCATTGATCTTGGAGGAATCGTCTGCGACCCCACATCGTTGA
TGGACGAGGACGACACCAACTGCCTAATTCGACGTTGAGGAGATCGCTGCCAATCCAATTGGAACGTGTGATTGTTCCCGTTTTCTCGTCGCATTCGATG
ATGGTGCTGGACTGATTCAATGATTCCATTCGTTGCCATGTGAATCATCTGCTTTCTTAATGCCACATTAAGCTGTGGGTTCATGAGCTTCTCTTCGTGT
TTGTGAGAATTCTCTCGCATGATCTCGCTAGCTTCAGTGCATCCCGAGCTGTCACCAGCAGGCGAAAAAGATCCATTGGCTATCACTCCATTCCTGTACG
GAGACTGAAGCGTCGAGTCTGCGACGTCCTCCGCGTAATACGAAGGGAAATACGGCGCATTGACCACAATCCAGACGATAATGTTAACGCAGCCACGAGA
AGCGTGCATGAACGCACTGAGGTCAATGAGTTCTCTGAAAAGTGTTTTTCCCAACACAGCTTTCACTGTGACAGTGTTGGTCATCGCAAACAAACAGATC
ATTAAAAATGACCACGAAATAAACACCGCACACGTGAGCATTCCATTCGACAACACACGACGTCGCACTTCAAACGTCTCCTCCAGCCCTCGACGCAGTC
GGCTTCGAACGTAAACCATACATGCAAGACCGAAGAGCAGATACACCACAACGCACATATGGTAGAGTATCCATTGATGCCAGAAGAAGCCTGGCATGTC
TGTGTTGTGGTGGAACCAGATGAAGCGTTGTTCATTGGCATCGACCACTTTCTCACAGTCCGGATTGGTATCACCAGCCTTGAGGCAATCTGCCTGCGCA
TCTCCAAGAGACCATAGTACCAGGCCACACACAATACCGCTGAGCACTGAATAAAACCAATAGACCCTGAAATTATGCGCGTACGAAGTGAACGGGTTAG
TGATGGACTGTACCATGTCGATGGGGATAGCGAAGAACCAAAACTCTCCAGCAATAAGCAGCGCCTGTGTGATAGCAGCGATGCGAAATGGTAGAGCCAC
AGAGTCCGAGAACTCGGTGATACAGTACTCGGCCACGTAAATCAAGGCCAGCAATAAATCCACGAGACTTTTACTGAAGATCAGCGGGTTCGGATGCGCC
CGCACTGCAGGACTTGTGAGGAAGGACACGATAATCACCAGAGTGAAGGATCCGGAGGCGATAGCTCCAAGGAACAAGTACTCGTCGGCACTGTAGCTGC
CCACCAGCGCAATGGTAGAGCAGGCCACACCCACGAGTACTAACAGACCAGCAATTGCCACTCCAAGACCAGAACACGGGCCCGTTACGAGAACTTGGAA
GCAGCTAAAGAGGGATAAGAGTCGCGTGGCACGTCTGCTACCCCTGTGTGGTTTGTAGTGCGCCTTGGTGAGATATTCGACAGTGGAGCCACTGGAGTGC
ATAGCAAATAAGAGTGAGTAGGTAGAATGAGGTAGAGCAAGACACAATGGACGCACTATTCTCTGGGCCGCAGCAGCGCGTCGCTCTCGGAGGCTGGTGG
CAGGTGCCCCATGCAATTGAAGGAGGTGTAGACGAGTGCTTGGGCCGTCCGAGTCTCTGCCAGTTGCGTCTCTAATATTGGATGTGGTGCCACTCATGTT
CCACTTATTTGGTACATAAAGTGTACTTAAATAGTTCAGGTTTTGAAAGTCAATTTCATGAGAGAGACATTTCTGTGGACATTTTGTGGACGCTTGAGTA
CATGTGGTTTTCCTAAGGAAAATGTCGACGTTGAAGCTGTTGCAGCACGCGATGACGCTGTGAGGCGGCAAGCGCGCCAACGATGCAGCCTGCAACGACG
GCAGCGCCGAGTGCAGCCCAATTCGTTGGGGGTGCTTCAGACACACTCGGCAAAAAGATTTCTTCCGTGTCTTGGCCCGATGTCATGGTCGTGGAGCCGT
TTGAGAGCATGGATGAAGACCGCATTTCTCTGCTGAGCGATTGTAGGAACTCCTTCGACACGAGCGTTTTCTGCTTAAGGAATTGCCGACAGTAAGTGCG
TGGCTGCTGGAACAAACGGGAGCGGGAGTGTGTCAGGCGAAGCTACAAACATTAAGCAAGACATGAATGTTAATCACTGAACAGGAGCTCTATCAACCCC
TCGTAACACCCATACCCGTGTTGCAATGGCATGGAGAGCGGTAAGGATGTCTGACATATTATCCTGTAGTGAATTTGAAAGAAGATGTTGGTTAATGACA
GTCGGAGCAGAGACGAAAGGAACGGCGTGTACGTACCACGTAATACTTGGCGCTACTCGGTTTCTTCCCAACAGTACAGGTAACGACATGCTCCAGTTGT
GGCTCGTTTTCAGCAAAAGCTTGGACAGCTGAAATACAAAACATAACTTTCAAGATGATTCCATAACAATTGCTCTTAAAAAAAAAAGTCACAAACCTTG
AAACATTTTCTCGTCCGACTCATCGTCACCGACGATAAATGCAAACTCAGGTATATCAATCCGATCCTTCAGAACCTTCAAAATCAACGAGACTGCTACA
GCTTTGCTGACCCCATACTGATGTACTTCCACGTATCCTTTGGCGCGGTTCACGATTGCATCTCCTCTCTGTACACGATATAATACGGGTTAACGATAAT
CATACCAAGAACATAAAAATAATCTACTCAGCGCACCTCGACGATCTTGGCGAGTTGAGCACATAGCTCCAAAGACTGGATTTCTCCATATTCTTGGTCG
CTATTGCGGTAGTCGTACAACAATGATGCTGCATTCTCAACAAGGAACGAACCATTCGTCCGCGCCGCATACGCTTGCATCACACGTTTCACATCATCTT
TCCAGTCGAAATTCCGCTTGTCCTCATCGCATACACACTCCCACTGCTCTCGATTCCCAATCTTGATAAACAACCCGTTCTCTGCTACCAGGTTCAAATT
TGGAATAGACCCAAACTGATCCTCAAGTGCCCCTCGCTGGGTATTACTGATAACAAACACAATGTTGCATGGATCACCACATAATGTCTGCAGATTAGCG
CGAGTCTCGTCAGAAATCGGCTTTCGAACCTTTCCGTCAATATATCGAGCGGCAGACTGACCAGTACAATCCGCACCAGACCGGTCACTAGCATCAAATT
TCTGAGTAGACTGCTCGACACACCCGGCACGGTGTGAATATTGCGCACCCTCTTCATCCAAGATGCTCGCAGTCGAACTCAAGGAACCGCCATAGTCAAA