Description :
From Genome Similarity Track
Location :
Scaffold_16:92615- 94133
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G006832Similar to Camkk1: Calcium/calmodulin-dependent protein kinase kinase 1 (Rattus norvegicus)
Pytul_DAOMBR144PYU1_G006831Similar to RRAGC: Ras-related GTP-binding protein C (Homo sapiens)

Sequence
1518 bases(100 bases per row)
CATCAGTGGCCCCCCTACGATACGTCGCATGAGCTCGGCAGCGAAGGCTCTTGACGACTGCCTGGAACTTGAACAGCAATCGAAGCAAACACCTGCCAAC
GCGTCATCCGGGACACACAGCCATACAACGACCTCGGTACTAGATGCGACGGATGTGAGCGATTCGAGTGGTGTATGTGACGACAATCCCGAAACGAGTC
CAAAGATCTTTCAGAAGAGGGAGAGTAACATCTCACCAGCCACCAACGCGAACGATAACAGTAGCATGTTCTCGCAGGTGATCGTCGCTGGAAATGGTGG
TGGAAGCCCCTCGAAGCCACTAGGCTCATCGAGTTGGCTATCGACGTCGGCACACGGGACTACTCCATTTGAAAACGTTGGCGACGAGCACATAGTAAGC
ACAAGTAGTCCTGACGCTTACCCGAAACGAGGCACAACCACGCGCGTGTTCTCCAAGCGCCGGTCATTGCTGGAAGCTCAGGACTCGCTGCAAGCTCTGA
TGCGACGGAAAGGCAAACTCATTCTCCACGAGAGCAATGGTAGCAGCGTGTATGACGCGCCCGACGATCGAGTCCCTGGCAAGACAGCGCCATCTGCGTC
GATGTCGACCATTCATGGACGACGCCCGCCGATATCGGCTCTCGGCTCGAGCGTGGTCTCGCTCATTCGCTCGACGTCAGAAAAGATCTTCCAGGAAACC
TCGAAATCTGTCGCTACGCTGCGCAGTCAGAAGACGACGGTCTGCAACGTCATGTAGCCTTCGATACACACGACACATCCTAATAATCTAGTAATGAAAA
AGGAAAGATCCTGCAGGATCTTTGTGCAAAGTGGAACTTCGGACAATCTTCGCCATCGGAAATGAGGAGGAGCTACCTAATCCGTTTGATTGACAAAAGC
GTACAAAAACCGTCCACTTATCAGCAAGATAACCTCACGTATAAAATGCACACATTTCCTTTTTCTTTCAAGCAAGTCACAAAAAAGCGACTTGAGAATG
CAAATAAACTACAAGAGCAGCTATTCTGTGAACATGTAATTTACACTCTTTGTCTATTTTTGCTATTTCATCATTGCCGTAGCTCATCTATCTCAATTTC
TTTCTACCTATCCTACTTTCCTACTACACTCCTAATATATGTAGCCTCATGCACCTTGAGCACGCGCATGTACTGTAATGAATGTAAACTTTCTTGGATA
GTATTGTTATTTCGCAAAACCTGCCGCATGAGCGCAACGAGTTCTCATTTTCCGCATCAGAGAAGCAACAAGCAGCAGCGATGGATCTAGGCTGGACCGA
GAACTCCTGTGCGTGTATCCGCATCGCCCATCATGCACTAGTGCTCTATGGCATCTCACCTCCTCGCTCTCTGTGTCTCTCCCTATGTATGCGCGTCAAA
CCGTCTAACGAGCAGACTCGGAAGGATACCCGCTTTCCCAGGGGTACGTCGCGCCATTCTGCTTAGTTTGGGGGGTTCATCTTTTGCCTCGTATTGCAGT
CACATAGTGGCTCTGTAT