Description :
From Genome Similarity Track
Location :
contig_164:9261- 10892
Transcript NameFunction/comments
g11851.t1hypothetical protein

Sequence
1631 bases(100 bases per row)
ATTCACACGAAGTCGTTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCACTGGATACTCGACCA
ACGCCTTGAATCTCGATCTCGACGTAACCCTTGACATGGCCACATACAGTTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCAC
CGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCG
CTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCGTGGATGACATGATCTTTGAGTTCGACGATTCGCA
GGCGCGTTCCGTTGCACAACCCGAGGTCGGGCTTTAAGTTCCGCATCATGATGATCGGCATCTCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACT
GATGTTCAGGGAGTTGAGTACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCACTGAGTCCGTGGACACATATTCTCGAGCTGGTCCAGTCATGC
GATCCGCTACGGCTTTGTTGATATGATGGATTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTATTCGTCCGTTGCGACTTCCGAATTGTT
GATCTCGGAGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATTGCTCCCGGACGGATCTCCTCGTCCTCATCTGGATCACCGACGGGGTTGTGA
TGAGCATGTCGCGTGGAATCTTAATGTAGTCATTTCCCAGATCGTTGTTTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGC
CATTTCTGCAGCACTATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTCTGGAAAGTGGCCACAGTCCGGAAGACTTCAGGC
ATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACGGGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTTCTGC
CTCATTATCCAAAACATCACGAAGCGTTCTGTCCACTGCCTCAAACGCGTGCCGATGCGCCATGGGTGCCTCATCCCAAACTATCAAACTTGCTTCCTCA
TCAATTCCGTGACCTGAGATCGCTTGTTGATGTTGCAAGTAGATTCGCCGTCTATCTTCAAAGGGATTTTGAAGGTAGAATGCGCTGTCCGACCTCCCAT
AAGCCGTAGAGAAGCAATCCCACTGGAAGCGACCGCGATTGCAATTTTTCCGGATAGACGAACCTTGACCAGTATGTTCCGAAGCAGTGTCGATTTCCCG
GTACCGCCTGGTCCATCAACGAAGAATAGCTTCCTGCCTTCCTGGGGTCCTCGACAGCTTGGGTGATCTGATCATAGTTCAAGCACTACTCCTCATTTAG
GTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGCACCAGG
CGAGGGTACTCGCTCAGCTGAGGGAGATTGT