Description :
From Genome Similarity Track
Location :
contig_66:92576- 94025
Transcript NameFunction/comments
g11292.t1hypothetical protein

Sequence
1449 bases(100 bases per row)
TCGTGGACGGCCGTGTAGTTGTAGTACACCTCGTTCTCGTACTCGCTGTCGCAGTACGGGAACGGCACGTCCGAGGTGGTCGGCGCGAACAGTGCCTTGC
CAGACGTGTACGTTACGTAGCAGCCGAGGAAGCTGCAGATGACGACAACAAACAACGCAGGGACTTTCTCCCACATCGGGATTTCGTTCCAAAGCTTCGT
GAGCAGGAAGATAATGGGCAACAAAATGCTGATCAGCGTGATACACGAAGCGCCAACGAAATCCAAAAAGTCGGAAAAATGGTCGCGGAAGATGATCGAG
ATAACCACCAGGATCACCAGGATAACGACACGGAGGATAACGTACTTGATCGCGTTTGCGCCACGGTATTCGGCAGCCTCTGCCTCAATGTCGTCAAGGT
ACGGGTTTTCGGCGTCAGCGTTTGAGATGTACGACATCTTGGACGAGAGGCGGCCGTCGCTGTCCTTACTGGGCGTGTTTGCTGCGCCGTACATCAGAGC
ATTTTCCACATCATCTTCCTTCTTTTGGTGCATCTTGAGAATCAGGCGCTCGGCAAGGTAGAATGGCGGGTTCAGAATGACGGAGAAGGCGATCGTAATG
TGCAGCTGCATGAAAAAGTAGGCCATGACGACGGCGCCCCAGTTCGACTTGAAGCCCAGCGTGGTGAGGCCGCTCGTCGAGTCCGGGTAGATGGAGAACA
AGATGTTGCCCGTGATCTGGCAACCCACGGCCGAGTACGCCGTGCTGGCCAGGATCAGGAACAGGCACGAGATGAAGCCCATGGTGACAAACACCACGCG
GGGCATGCGTGTCGGCTCACTGTGCTGGCGCTGTAGGGCCGGAATTACAATACCCGCGTTGTACGCGACTGCCAGGTTGCCGAACATGCCCACGACCTGC
GAGAACTTGATATCGGGCGACGGCGCAGACGGGTGGCCGCGCATGCAGTACATGACGACGGCTACGCCAATAACATCGGCGATGATCGTGCCCGCGCAAC
CAGCGAAAGCGACCCCAGCACCTTCCTTGAGCGTCGGGATGAGGCAAACGGGCAGGCACAGGAGCGCCATGAAGCAGATCCAGTAGGTGGTGCTGAAGGC
ATCCGGGAAGAGGCCGTCGAGCAAGGTGCCGCCCAGCACAAGTAGCACACACGGGCCTAGCAGACACGAGGCCATCTGCGAAACGACTGCAACCAGTGTC
CCCACTTGCCCATGCACCACTCGCCTAGGTCGCTGTAGGTCTTGACACTCTTAGGTGCCAACAGCATGACGCGGCAGATGGCAACGGAGGAGTAGACGTT
GGCGAAGGCCATGAACGCTAGACCGACGATCCCTAGCACGGGGCCAGCGCGTGAGAAGTTGCCAGGCATGCCAAGTGTACCAATGCCGTAGACGCAGCAG
AAGATGTTTAGAGCGATCTTGAGGTCCTCCGTCGTAAAGAACCTTTTGC