Description :
From Genome Similarity Track
Location :
Scaffold_55:92535- 94717
Sequence
2182 bases(100 bases per row)
TGGGACTCCCTACGATCCAACCCCTATTTCGACCTCCTCCAAGAATTTGAGGACGTCTTCCCCGACGAGGTACCGTGTCGCCTCCCGGTCGACAAAGGCG
TTCAACACGAGATTGACCTCGTGCCCGGCGCAAAGTACTGTGTAACGCGGCAATGGCCGCTTCCTCGCGACCAAGTCGATGCCATCGACGCTTTCTTCGC
GGCCCGCAAGGCGGCGGGTCACGTCCGCGAGAGCATCTCCCCTCACAGCAGCCCGACCTTCTGTGTGAAGAAGCCCGGTGGGAAATGGCGTATTGTGAAC
GCAGCCACGATTCCGGCTCAGACGCCGATTCCTCGCAAGGACGATATTATCGACATCGATCCACCATTTTCTCCACCATCGACCTTCGCGATGGCTTTTA
CCAGATCTTGATGGGTCTATGCAACGTTCCAAAAACGGCGGTCTCTAGGCCGAGCGGCATGTTATGGGAGTGGCTGGTCATGCCACAGGGTCTATCCAAC
GCCCCGGCGACGTTCAATCGTATGGTTACCGCGAAGTTCCGCGCGTTTCGCGACTTCGCTCCGTCGTACTTCGACGACATTTATGTTCACAGTTGCGCAT
CCTCCACGCAATCCGATCTTGACGTTCACCGCGGCCACCTCCACAAAGTGCTTGAAGTCCTCCGTGCCAACGGACTCTATGCCAACCTCGCCAAATGTAT
GTTTGGCGTTGACGAAATCCCAGTCCTGGGCGATTTCGTGGGGGTGAACGGATGTCGGGCTGATCCTGACAAGATCAAGGCCATTGCGGAGTGGCCTATC
CCCTCCTCCGTCAAGGATCTTCGTCGCTGGCTGGGCCTTGCGACGTACCTGCACAAATACTCGCAAAACTTTGCGGACATCGCCCAGCCGTTGTTTCGGC
TTCTCCTCAAGGACGCCCCTTGGGTTTGGGACTCCGCTTGTCAAGAGGCTTTCGACGGCCTCAAAACCAACCTTCAACGCGCCCCGATCTTGGCGCTCCC
AGACTTTGACAAACCTTCCTTTCTCCGTCGTTTGTGACGCTTCGCAATTCGCCATTGGCTGCTGCCTGATGCAGCTCGACGCCTCCGGTCACCCTCACCC
GGTCTCCTACCAAAGCCGCCAACTTCACGCGGCTGAGCGGGCGTACCCAGTCCACGATTTGGAACTTCTCTCCATGAAGTACACCCTGACCAAGTTCCGC
ATCTACCTCCTCGGCGGAAAACCCTTCGTGATCTACACCGATCATACGTCGCTACGTACAGCGACGAATACACCCCACCTTTCACAGCGCATGGCGCGCT
GGATTTCGTTCTTCTCCAAATTCACATTTTCGGTACAGTACAAGCCCGGGAAGGACAACATCCTGGCCGACGCCCTCTCTCGGCGCCCTGATCTCGAACT
GACCACGATCGGTCTTTTAACGACGGGTCTTCACGATAGAATTCGTGAAGCGTACCCCTTTGACGCTGACTGCTCGTCGCGTCTGGCGGCGCTCACCGAC
CCCGTTTCCCCCAAACCCCGCCGTGCTTCGTCGGCCTTACACCGCTTCGCCCTCGCCGATGGGCGTTTGATATTTTCAACCCACCGCGGACTCGCCGCCG
CGCATTGTTGTGCCCGGTGACGCGCAACTGCGCCTCACTCTCATTCGATCCTACCACGACTCCCCTAGCGGCGGCCATTTCGGCCGCGACAAAATGCACG
CGGTTCTAGCGCGCTCATACTGGTGGCTCCGCTTGTATAAATCCGTTGTGCGCTATGTCGCTCATTGCGACGCTTGCCAGCGCACTAAGATCACCGCCTC
CTCTCGGGCTCCGCTACAACCTCTGCCTATTCCGGACGAACTTTGGTCGTCCGTCAGCATGGATTTCATGTTTGGCCTGCCGCGCGACGCCGGCATTTTG
GTTTGTGTCGACCGAGCGTCGAAGTATGTTATTGCCGTCCCCGTCCGGGGCACGATGAGCGGCGGAGATACCGCTCGCCTCTTTTTCGATCACGTTTTCT
GTAGTTTCGGCCTGCCTCGCTCCATCGTTTCAGACCGCGACCCGCGGTTCACGGCGAAGTTTTGGTCCACCTTATTCGCTCTATGCGATACCTCGCTCGA
TATGTCGACTTCGGATCACTCCGAGTCCGATGGCCAAACGGAACGTGCCAACCGCGTCCTCGAAGATATCCTCCAGAGCTAC