Description :
From Genome Similarity Track
Location :
scaffold_74:9253- 11454
Sequence
2201 bases(100 bases per row)
TGTTATCAGCAATGGTTCCGGAGCAATTTTGCCAAAAtagtgcgtagcgctgctacagtctctcgggagcaagaaggttggagactcggataagaagttg
tcgtcgcgactgcgtacACGGTTGCGCCGATATTGTATAATGGcctgctgtattatagcgccGACTCaaaggatacgccacgaattgtggttccttacGA
TGAGGATTCGAAGTGCCGTATTCTCTAGTACCTAAAACTTCCAAAAGATCTACCCTCCATTTCACTTTCTTGTGGTTACAGTCCTGGTGCTCCCGTCGAC
ATATTATTCGGCCCATGTGGGAGTGAACTACCCCTTACTCACCAAGCAGACCTGACAGTGAGAGGCCCTCTTGTGGCTTGCTCGTGATCTCACTCGGTGA
TGACGGTTTGCCAACTTTCTTCGGTGTATGGTCGATATAGATACGGGTCAGATTCGAATGCTCTATATAAGCTGCGCCATAGTACGTAGTAAATTCAACA
GCTCAGAGTTGCATCTCACACTTTAGCAGAGCGTACCTCAGTTAAAGCGGATGGTCCAGATGTTGCTTTGTCTCATTGAAGCGCTTCACATCTGAATGGC
TCGACAAAGCGCAGAGTTGGCGCGGATTTAACAAGTCAGCATCAAACAAAGGTTGGAGTGTATGATCGTCGTAATCCTTAATTTTTAAAATGGTCCAAGC
TAGCTGGATTGCGCATAAATATTAAAGTATCCGTGCATGGAGATACTCAATAATCAATAAACCTTGTCCAGTTCCATCTGCTCATGGAGTCTGCATGTTG
CTTATGCAGATTGTGCTTTTCAGCCAAAGGGTCTCCAGCTCTGCGCCTGACGCTCAGaatcaaattttaaatttgatacGAAGTTTAGCTGGGTCGATTT
TAACGAGAAAAACTTCATAATGTCCGCTCTCCCAGCAAGCCTAAATTGCGGTGTCGAAAGAACATGGGGGCTTGCAAATCCTCCATGTTAATATGAGACA
GGTTCTCGAGACTTCGAGGCATGCACAGAGATACACAACGCATCATCAATGTATAAGAGCCCTTTGTTCTTGTCATCTGCATAAGCTTGTGCTAATGGGG
ATACCCTGTCTGGCCACCTGTCTGTGTCTGGTCAGTGGTAGAAATGCCCAATCTGGTACACAACACCTTTATTGAAATTTTGTCATATCCACTGACGATT
GCGGGTCTTGATATAGAAAATGGTCTCCAACAAGCAATATTGGCGGAACCTTTATTAGGAAGCGGCTTGGCTATACCCTCACCGGTATCGGTGTTGCTGA
ACGCAAAACGGTGAAGTTTTGCTTAGACGGTCCACTCGAGCCCATGTAGAAGCTTGTCGACTGATACATGCTGTATTAATCACATGGCGTTCACTGAGCA
ATTTTTCAGGGGTGGACACCATAGATATGTGCCTCGTACAGCATTTTGATTCTAggatcttcatcatcaataCATCTAGTTCCTTTTCGTACGCTAGTTC
AATGCGTTGTCGCAGTCAAAATAAGCAAaatcgcatccgccacagCATTAAGCCAATTTGGCAAGTACCTTACCTTGTCGACAAAGATTGATAACCGTTG
TGCATTTTCGTTAAAGATGTAGTAACGACAGCGCATTGCGCAGCAATGTATGAGTTGTATCGACCGCTTAagaagccaagcaggtgcactacaaaattga
tgaggacattttcattgcaagtagctccttgaaATGAACAGGATTGCCCTTTTCGACCACTTTAAGCTGGCGGGGCTCAAATGTGAGGATCAGTTTGCTC
CCATCGGCATGTTCTCGGGGAACTGCTTAGCCTATCGCAAAGGCTAAAGTTTTACAGACGACATGGAATGGCCGATCTGGATTTGGAAGAGCCAGATCGG
GGCACCCATGAGGCGTTTTTTAAGTCTTTAAGGCCACCTATTTGACGCCCTTATTAAGGAAATAAGTGATGAGATGTACTATTAAGGCATATTTTGAAAA
GTCcttgtgcaagaagttggTCGGGATAAGCCACTTCCTCCTAGTCCACTTGCGACAGAAAAACTGGTCAATCAACATTGATCTTTAACCTTGTTAGATC
TCTCCAGATAAACAGCTTGGCAAGGTTTTCTTATCCACACCGAAGCCAAAGTTGTCTTAATTGACAGACATTTGATAAACGCAAATAGCAAAACTTATAT
T