Description :
From Genome Similarity Track
Location :
Scaffold_94:92513- 93515
Transcript NameFunction/comments
g11221.t1RAW30740.1 hypothetical protein PC110_g12906 [Phytophthora cactorum
g11222.t1RAW30737.1 hypothetical protein PC110_g12905 [Phytophthora cactorum

Sequence
1002 bases(100 bases per row)
GGAGGACGAGGGGCGAGTGTACAGGATGAAGGTCAGGAGACCGCAGACGTAGAGCACACCACAGCAGAGAAGCAGACGCGGCCAGCGACTGGAACGACCA
GTAGAACGACTGTGGCGAGGCAGAAGCGACGACGCGGAGGCGGACGCGGCGGCCGGAGCAGTAGCTCTCAGCATTGCTGACTCAAGAATGATTATACCGT
ATCATCTTAGACAGGTTCTATCATCTTAGTCGATGTTTCAGCCAATCCAAATGTAGTGTTTGATCCAGGCTCTTGCTTCAGTTTGGGGCCTCGATAGTCG
ACACAATGGGATCGTCTCAACCTCCAGTCGCAACTAAGAGCTGGCTGCCCCGTTCCTCTACGGGTCGCTGGCTCTTGTGTATACTGCTGCTGAGCTCCCT
CTCATACACGTCGCTGCTGCTGATCTGGTCCAGTGACTCGCTCTCCCCAGTGACTCGCAGCTCCATTCGCTCTCCGGTTGCTGGCGGTAATGACTCGCAA
TTGCTGCAATTGGACGAAGTGAAGGCGCTGCCAGTGGGCGACAAGAAGCAGAGAAGTTTTCGCTGTATTGGCTGGCATGCCACGCAGGACTGTACACCGT
TCGGTCCTCGAGACCCGACACGAGACCAGCCTTGCAGCAGGACAGTGCACAATTCACCCGCAGGCTACTGCGAAGTGGAGGACACGCAGTCGGGAGAACG
GTTCCAGGTTATGAGGCGGCACTGCACTAGTCTCTTCCGAGCTGCTCGGTTTCGCTGTCAGGATGCGTTGGCGTTTGTGGATTTTCGAGTGAAGGCGCGC
AAAGCAGTTGAGAAGGCTCTCGTTCCTGGGTTCTCATTGCCGAATGTGGTGACAAACGCAAATGATCAACCGACCGATGGCATCGTGATTGTGGTGTACC
CGAAACTTGTGGCAAGTGCCTACGCGCTGATTCGAACACTTCGCGATGTTTTGGGCTGCAAGCTGCCAATTGAACTTTGGTACTGCCCCCAAGAACTCTA
CA