Description :
From Genome Similarity Track
Location :
Scaffold_125:9251- 14934
Sequence
5683 bases(100 bases per row)
tcctgcttacatctcgaatatctgtcggtagactatattctgcgtgtacgcgccgtcgtcttccacatgctctggatactcgatcatcaccttgagtctc
gaccgcgccgtcactctcgacagcgccacatacagttgtccgtgggaaaagcaaggacttgacagatacaatccaagattttgcaccgtttgaccttggg
ccttgttgatcgtcatggcaaacgctggttgcactggaaactgctttctgcgtagacggaaagggaactcccgcgtgtccccgttactgaggaacacaat
ccgcggactgaaaacatcctggccatggcgctcacctgtcatgatagtcgcgtggatcacatgtggcttcagctcaacaacacgaaggcgcgttccattg
cacagccctaggttggggtttaagttccgcatcatcatgatcggcgcgcccttcttcagagttaacttgtggggtgggataccgttcatgtccactgaat
gcaggagctctggctcgaagtagtctgcgtcaccgtcgttatccacagaatcattggacagatactcttgggcctctccttccagcttctgcgagacagc
ctcgttgatgcgatggaccatcatgttcgtcgtcgtcaaaatcgtgcggctggcaaagtactcgtccgtggtgtcctctgggttgttgatgtctgcatac
atctcttcaatgatacgccgtaagcccctgggagtggcgcctggccgaatctcttcgtcttcttccggttcctcatctggctcgttctcaatcaacatgt
cgttcggaatcttcatgaagtctgcccccaactccggattgacttcgtgtctcccttcacccactgaagaaggaagtcggagaaggctgtaagttcctct
gcggtggtttcgttaacagcggatctcactcgcatattctccgtgagatgaacttgatcgaacttgttccacagctccgaagccttaagacacgcattga
tggtgtccgcaggtgttccctgcactaccaccggaagaatctgcctgaaatcacccgaaagcaccattacctatcctccaaaaggttcatcgttatccag
gatatcacgtaacgaacggtccacagcttcgaatgcgtggcgatgggtcattggcgcttcgtcccagatgatcaagctcgctatcgtgataagctccttt
agtggggagcgcttgttgattgaacacgtcgactccgcgttcaacttcaacgggatccggaaggtagaatgcgccgtccggccttctattaacagaagcg
ccacaatcccgctggacgctactgcaatggcaatattcccagataaacgcactttagcgaggatatgtttgagcaaggtcgatttcccagtacctccagg
accgtccacaaataacaacttgttgcccaccgaagatccatcgacggctgccattactttcgcgaaaatagcctgttggccatcattgagttcatcttca
tgctccacaatgtcctggagcgtgtgatagtcatacaccatgctctcgcgttcaatgagactgttatcggcctgtagtgcttcccgaataagtagatccg
ggaactggtcaagttgcggcagatcaaactcagctaccgcttttccgcttacttgaagcaactcgttcagactcttgagtgtgttaaacatcaccaactt
gtcctttgcctggccttccatggcgcggaaccggcggctgaagtcatcgggcagtgcttcgtagaaatcatcccatagctgacgcacctgcgcaacctga
gagtacaccaaaagcgtagcgaaaagctgacgcaactgataagccatctggaatgtcgcggcttcctccatacaggctgcccattcttcgtcattctcga
gatatcccaagcgtacagccgcgtccttgtacgacccacagacgacgccgtccacagttcgaaggtccacaaaggaagtagggcctttgcggtgacatag
caacacgcgcaagtagaatctctcttcatctcttggagacacgtgtaccatgcgtcctagtgctgcttggtactttttgcgacggacccaaatcttgtgt
ttgtcccagcggaagtactttgggatatcctggtacacaattgtcttggctacctggtcctcgggggcttcactcgcgcatatctcgaagaaggcggtaa
gcttagtgcgctcattacggtcaatgacgcgttccgggtcgtcagtctcccggaaaatcaccatctgctcgccttcgaggtgcaccgttagcagaaagac
cgcgtgggtctttccctgaacgacgtgcccgaggagacgcatccacgcctcaactggagagatgtaccgcgcggttaagtatcgaatgatctcgttgggt
ccccctgttaacagtagcctcgcctgacaccgcctccactgtaatcactgccctgtcggatcccttgtagacgtacttgtacaggtacttcaccaccgag
agcgccgtgcatatttcaatgttgatgtggcaattgtacttctgtgaaaagtaaggattgtacggtaccacccattgattcaccgttgcgttgtcgtact
ctttccctttgaagaaaagcactccttcgggtcgacgtcggcgcctgtactgcggaaatccgtcatcattggcccgcgtcgtttccgccaacggtttcgg
gtaaccctttgtacacttgccgtccttcatacatacacatgatgggtttgctgcaccgcatgggccatgcatcatggacgtcatgacagtttcaaaaaga
cccgggttagtctcaggatccggtatttccgccgacacgattttgtcaataatctgtctcgtgcgaggtttgtcctcgtctgccaaaatgactaagatgt
gagcatgcggaagaccacgtttctgaaactccacaacgtaaatccgtgctgcaacctttccaagtacaccctcgtccaagtcttttaaatgagcagccag
cttctgctgccacaccctcgcgacgatatcagggcgatcttgggcattctgatttgggtcagtaatcttctccttgatttctccccacgtaggattgcaa
gtcatggtatcgaagatgtcaggcttgccgtattccctaacgatagccatggaatcttggtacgattggtacatctggcgcggacttccggaatgcgaag
acggcaagatgaccttcttaccgacttgattgaggaagtgtttgttcctggcacgatctggatgagccagctctccagtgccacgatcatattccgccag
gagtccttcgccatcacccaagatagtcctagcctcttccatagcttcatgtaggtacgcgtctcgtaggccattgtattgataagcacgaatctctttc
tggtgagttgcgatccagcgaagttcttcttgttctaacttggctctctggtccacgcagtactgctggaagagacgtcctccttgatggagggctgctt
ggtcgtcctccttttggaatagccgatacgccacgtgctcacgtaacgccatagctcgtttgttcctgcgcacgacatcgccttcgtatgtatcagtgta
tgtccaccccagttctccatatggaagaagtaacggatactgaagggaatcgtagatagcacgcgtctcgtagaggcgcatgaggcttctatcctttgtg
tacaccaagaggtctcgaggctgcgcgaggttgccgtcttcaatcatcgtggccgccacttcagaaactgttggcagattttccgttccaggtctggacg
ggttgtttttcaggcggaataccaagtcgatcggttgctgcatatcgttttggcgcaccctctcgccaaacgtgaggaactgctgggcgaacgggttgtg
cctttccatcatctgctcgatgtctaacagagccacaggatccagatcagcaaagattcccctacgtctctccgcgcggcgctgcatatcgggatcaacg
atatagatctgcgcaaacttgggctccgtcctctggccggtttggcgatctatgtatggcagcaacgaacccaggtagtgacccatagcgccttggatcc
ggtaggtgtacacgccacgttctcccgccacgctgttgtcctggttaacttgctgaaatcttcctgttgacgggcttgatgcgccgatagacgtaaaggc
aaaggcctggttgtacgcccgtacgcgctttcgaaactcagggtctccgtaaagctgaagaagttttgctggcgccggagccagaggtggtagtttgact
ttcccctcgagacaacagcccaccttgctttcaccaggccatttccacgcattgcagtgggcgcacaccgtagtaggaggaagcctgtggcgcctagtct
cttcatcaatatccggacccgtgaccatttccgggcggaagtcttcgtggttcgcaagtgcgtcgcagtggcgggtggtgcggcggcgttcacgaacacg
ctcgcgctcctcttcgcgttcttcctccgtttgtagcgcccttctcacctcgtgccgctcacgatcgcgttcacgttgtgcctcgcggtcttcaactgac
tgttgttctcttgcagttagacgacgttctctgtctgtgtgatgctgtgcatcacgctcttcttctgtctggagggctcgtctagtagcatgagccacag
cgttaacctcacgctcctcctttcgctcgtcctcggtttgttgggagcgccgtacggctcggccaacagtgtctctttcacgaacaacggtacgttcttc
ctctgtctgttgagatcgccgaatggcctgctgttcacgttcgcgctctcgggtaccctgagtacgcagtggcctctgggcctgatgccataaccgatcc
cgttcgcggtcggcttccacttgttcagctcttctctgggccctgcgtagccccttccgttctgcatccctcttccgagtgcgttcgcgttgggaagagc
tcatgttagctcgtcgagctcgggctctctctgcatcacgcatccttactgtcgcagcgctggaggtgttcatacttggagccgccaccaagcctacagg
tactgtcggtactccatgattcacggtggaatcatcgccaaccgaaacattattcacccgttcacggtgcaaacgctgtcgttccgcgtcgctcaggttg
gtatgctgcatggaaacaactccgtctgcctcaactatatcttgttcagtttctcgagcaagtagggctctcaattctttgttgagcttgcactttcgac
tcgaaagtcggctcagtcgacgcttcttacttgcatggtcttctggtccttcggggacaccattcacccgttcgttttcgctgatgtccgcttcaatctc
ctcgcgggttcttattcgtctgacacgaaccatgcctgcgaacacgaaacagagtaacgtgacgcgttagacttaacgtccaagtacactgtatgaagca
gtagttgtgtgttttgggtcttcgactactcgggtgatgccagctcccatcgaaattaacaccgatcattttcccacaatcaacagactttacagtctgg
tgcggtattcgttgcaaattgtgcagtcggtaagtcagggttagagcgcccgagtagtactctgttcttggtgcgatatcctt