Description :
From Genome Similarity Track
Location :
Scaffold_1820:925- 3112
Sequence
2187 bases(100 bases per row)
CGCTCGGCTATCCCTCCCCCATCAAGCCCTGAGCCACTGCGTGGCGACGTCAGTGGGACGCGAGGGTTAACCAAGCCGTTCACATAGAACGGAGTGTAGC
CTGTCGAGGCGTGCACTGCATTATTTAATGCGAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGAGGGTATC
CTCCACAACGCGATTAACGCGTTCGGTTTGACCATCGGTCTGCGAATGGTCCGCTGTGGACATGTCCAAACGAGTGCCGAGCACTCTGAAGAGGGACGTC
CAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGACTCGGTCTAAAAACAGCAAAGCTGTACCTT
CACCATCAATGGTGTCCGGCACTGCCGCTAATGAGCCATCTTGCTCAATCGGTCTACAAAGACCACTATGCCCGTGTTTCCCGCCTTATCCTTGGGAAGG
CCAAACACAAAGTCCATACTCATGGACTGCCAGCATCCCTTGGGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTTGTCCGTTGAC
ACGTTTCACACGTGCGTACATAGGTGCCGACCCCCTTATACATCTTGGGCCACCAGTACATCGAGCATACCGAGCCATAGGTCTTCTGCCGACCTAAGTG
TCCGCCCACGGGCGTATCATGAACCTCGTTGAGGATTCGATACTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGTGCTG
TAGTACAGCAGGCCGCCATCGAGTGAGTATCGATGCAGCCTCGCGCATAAGCGCCCAGACAATTCCTTGTCAGAGTCTTTAAACGCTTCGCTCCCAAGAG
CCCGTAGCAGCACTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATCAAGTCATGCACTGACGACGTCACTGTCGTGACATGAGCTAACTCGTAGTC
CGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATT
CTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGA
CTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGATCACGCGTTCACG
CCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATC
GGAGCCTGGAGAAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCGACTTTCCAGCACCATGGTGCGTCCTTCTTAAGTAGATCTGATAATGGCC
GAGCCATCTCCGCGTAGTTCGCACTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCCAC
GATGGCCTTGACTTTGGCAGGATCTGCCCGTAAGCCACGCTTCCCAATGAAGCACCCGAGGAAAGGTATCTCCTCCGCGCCAAAGACGCACTTGTCCAAG
TTGGCATACAACTTACTAGTGCACATGCACTCGAGCACCGCTCGCAAGTGGTCAATGTGGTTTTCCACGTCTGACTTTCCGTGCTCGGCACGACTATGGA
CGAATATTGTGGTGAAGTGCTTTCTCAGAAATAAGAGAATGGTCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTATAGAGGATT
TGGGTTGTTTGGCACGGGTGCAAGTTGCCTGTGGTGGATTAGCCATGGCGAGCAGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGATGTACGA
GAAGGCAAGATCCACCAAGACTTACCTCGGATCCACCCTTACCTGGATTCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGTGGATC
CTATGAAGGAAGGATGGTCGGTGCCCTCTGACGGTGGATCTAGTAGCCACGGCTAATGAAGAGTCAAGATCCACCGCGAGGTACCCC