Description :
From Genome Similarity Track
Location :
Scaffold_177:9249- 12763
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_177-snap-gene-0.12ADP-ribosylation factor
Pytul_var.sporangiiferummaker-pug3_contig_177-fgenesh-gene-0.7DnaJ domain protein

Sequence
3514 bases(100 bases per row)
ACGCCGCGGAAGGCTGCTGCGAATGAACATGAGTACCTGCGGCGGTTCGTTGACCCCGTGCTGATGCCGCTCATCGAGTCGCTGCTACTGTATCAGCCCG
AGAGCATCTACGAGTTTATTCATGACTATGTGGACGAATCCAAGTCGTCCCGGTTCACGAAACATTCACCGCAACCCGGGTACGCCAAGAAGCTCACGAG
CCGTCGAAAGATGGTGGACTTCATGTCCACGAGCGTGATCCCCGTCATGGACGACCTGGCGCATCAGATCTTACGAGAGAAACCCAGCTCCGTACACAGT
GAGCGCAATGTTTGCATGTCGTCTTGTCTTACCTATAGCTGGTGATCTTTGTCTAAACCGTACTCATGCATGCGCAGATTTCATCAAAGACGTCGTTGCC
GCTCGCATCATTGTTGGCAGCAGCTCACAATTCGACTCGAATCAACTGGAGGCCATTGAATACCACATCAACGATAGAGTGGTGTGTCGATACAAAGGAC
GGCCGCGATACCTTCCAGCTGTGATCACAGCTATCCATCCCGAAAACGACTCCTTCACAGTGCTGTACAACGACGGCAAGACTGAGCAGCACATTCATCG
CATGTGTTTAAAACCTGCTCCACCAGAAGCAGAGCAATCGCAGCGAGATGGCGACAACAACCAAAGCACGAATGAGAGTCGCTCACGAACTGCGGCTGAA
GCTCGAAAAACTCAAGTCGAAGCATCAGAAGGCGGGACTCGAACGCATTCGATAGAAATCGTGATCTTGATAATCGGAATCGATGGCGCTGGTAAGACGA
CACTGCTGTCGACCCTGCAAGGCGACTTGGACAAGGAGCACGTCCCGAGCGCAGGTTTCACGTCGGCCACGTTCCAGACGGCGACTGGATCTGTGACGTT
CTACGACCTTGGCGGTGGACCAGCGTTCCGCGATGTCTGGAAAGAGTATTACGCCGATGTAAGTGCCTTACAAGTGAGCATATTGCAAAACGAATGCATA
GGAAACTGAGAGAACTCTCGTTTATAGGCGCATGGCATCATGTTTGTCGTGGACTCGTCCAATGAGCAGAGCGTCCACCAGTCCGCTGTTATCCTGCAAG
ACACCATGACGAATGCCAAAATGGAGGAGAAACCCTTACTAGTGTAAGTGCAAACTGGTGTTTAGTCCAAAAGTCATGCTCAAACTTTGACGCTGACCTC
AATTTATGCCACTAGGTTTGCAAATAAGCGCGATCATCTGTCCGCGGTCCCAGAAGATACTTTGGCTCAGCTCCTGCAGCTGCAGCAATTCCCGACGTCC
AAAGTGGTCTCGTGCATCGCAAAGCCGTCCGTGAACGGCAGCATGGTGGACGATCGCCTTGAACTGGGGCTCCACTGGCTGCTCGACCAAGTAGACAAGA
ACTACGACAGCTTGCATGCACGTGTCCAGGCAGATCTGGCGCTCAAGAAGCAGCAGGACCAGCAGCGACGAGCCGAGCAGCGGGCGCGAGTCACCGCCTG
GAAAGAGGAGCGCGAACGAGGAGAAATGGTACTACACGACAAGCCGTCGTTAGCTCCTCCTGAAGAGCCTCGACAGGTAGAAGCTACAAGTGGAAGCAAA
AACAATACCAGTAAGCAGCAGACCACAAAGGAAGAGCAGCCTGAAGACGCCGTGATCTACTGCTCTAACTGCACCGCAGCGCCCGCAGTCACGAAATGCT
CGGCGTCCAAATGGATGCCCGTGTGCGCCGAATGTGCCGCTGACCTCAAAGCCAAACCCCAATAACACAAAATATCAATTCCAAAACAATTTCTATGGCT
CGGCTTAACCCCTCTATCTTTTCTTGCCCTTGGCACCTTTTCGACGCGAGCCACGACGGCCATCGTCGCNNNNNNNNNNNNNNNNNNNNNNNNATCACTG
TCCCAGTCGTCTTCCTTGTCGGCCCCCTTACCAGATGCTGGTGGTGGTGCTTTCTCTTTACCTTTTCCACCTTTTCCCTTGGTACCAGACACGAGCTTCT
CGACGTCCTCTTTCTTCTTTTGCTTGCGCTGGTCTTTCCGCTCTTTCCGCTTCTCTGCGGCCTTTTGGTCTTTGAGCAAGCGCGCCTGTTCTGCAGCCGC
TGCGGCTTCTGCTTCTTTCGCGCGTTTCTCCAGCTCTGACGGGTCTTCTTCGTCCAAGGCTTGCGGCGATGCTGCTTCCTCATCACCTTCGTCGCTCGCA
TTAGCATGAGCGCCACCATTCTTGAGCTTTTTTGCAGCAGCGAGCTCCGCCTGTATCTCCAGCTCGAGCTCGGCTTCGATCGAGTTGTAGTCGCCCGCAA
AGATGCCGAGCTCCATCTCCATGTCGCGGTGCTTTTTTGAGCTCAAGTGGTTGCTCAACTGCTTGGGCGACTTGAACGTTTTCCGGCACAAGTCGCAGAG
CAGCAACGCCGCGNNNNNNNNNNNNNNNNNNNNNNNNNCATTTTCTTGCGCAACTTGTCCATTTCGGCCTCGATTTCCGTATCGGCATGGCGACTCGTTT
CGCTCTTCTCCCATCGCTCCTGCTCCTGCTGCTGAAATGCCAGTCGCTCGGCTTCGTACGCTGCCTGCTTTTCCTTCCGCTTGGCTTCCTCTTCTTTCTT
CTGCTGCGCCTTTTCTTTGTCTTTTTGCTTCTTGTACGCGAGCATGCGCTGGTCGCGACGCCGCACAAAGTCCACGAGTTCCCTTACTTCCGACGTAAAC
GCCTTCTTCGCAGCATCGCGGAGCTTCTTGTTCTCCTTCTCCATGGCGCGACGGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCGTCGTCT
TGTATGTGTCCACCCACGCGAACGTGCGCTGCGTGATGTAACTCGCCCAGTGCTGGTAGAAGTAGTTCACGTCGTCCATGGACGTCTGCTTGTCGCCAAA
CACTGGCGCAGGCTGCGGCTTTTGCGAGGACGACACGACGCTCGCAATATCCAAGTCGTCAATCTACCATTCCACAGTGATTGCAATTAGATATGAACCT
TTCAAAGACGAGTTCACACACAATTAACAGCCACAAGCGCACTCGTACCTTCTTGAAGAGGCTACCGTAGACTGCATAGAAGCTCTTGTCGTCGCTACCA
AAGCCAGCGTACACCGATGGGCTACACACACACACGCAATCCCATCAGTAATCAACCCATAATGCATATACAACTCACGCAATGCGCGTGTATCTATCTG
CATTGCTCACCTAAAGTACTTGAACAGGTTGAGGTTGTCGCCGCCTTCGTCGTCGTCATCCGCGTCCCCGTCGGCGTCTCCGCGCAGGATCTGGTCGCGG
TGCTCGTCGTACCACTTGCGCTCGTGCGCGTCGCTCAACACCTCGTACGCGCTCTGGATTTCCTGAAAGCGCAGCGTAGCCTCGTCGGGCGAGATGTTGT
TCTTCTGGTGCTTGTCCGGATGCCACCGCAGCGCCTGCAGGTGGAAGCCCTTCTTGATCTCCTTGGCTGTCGCGTCGCGCTCGATGCCCAGCACCTCGTA
GTGGCAGCGCATGG