Description :
From Genome Similarity Track
Location :
contig_11:92485- 93649
Transcript NameFunction/comments
g3194.t1hypothetical protein

Sequence
1164 bases(100 bases per row)
TTGCGTTCTAATGGATGTGTTGCATGTCTTGCACTTCTTGTTCCAGACCTGGTGGGAGTGAGCCACGAAGACCTGGCAGTTGCAGGCGCGGCAAGCTCCC
ATCATGCGGGACATCTCGGCCAGCACCTCCTTGCGCTCTTGGATGCCGCGCATGGCACGGTCTAGCGCTTCATAAAGCGGTCTTGCTGCCATGGGCTGAC
CTACGGATCCACTGAGCAACGCACTCGCCTCGAGGTCTTGCCCGTAGAATTTCCGGTTCAGGTCGTTGCGTGTAGCGATCACAGAGCCCTGAAGCGAGAT
TCCTGCGTACAGGCCCTTGCTGATCGAGTAGCTGTAGTTACCATTGAGGCCGGAGCTGCTGATCGCTGCTGCAGCCGCAGCAGATCGCCCATAGGGCCCA
AGTGCGATGTCCAGTCCCGCGCCCAAATTCACTTGAGGCGAGTGGAAAACCTGCACGGAAGCCGGGGAACCGAGAATGATCATGACCTCGACGATCTCTC
CGCCGATCTCAAAGCCGCCGCCGAGCCCCACAGTGCCAATAGCTGAGGGCGCAGACCACGAGCCGTCCGGTAGTCGGGACACGACGATACCCGTGCCCAC
CTTCCCGACAACGAGGAAGCCAGCCTTGACGATCGTCATGACCGCCAAGCCGTGTGCGTTCTCGAGCATCGAAATCGGGATGGCCCTGTCCCCGGACGTG
CCCGAGTCGTTCCGGAAGAAGTTGCCAATGATATCCGCTGCGTTCGTGCACTCCTTTTCCAACGAGGGCGAGAACGGCACATGCAGCCTCGACTTGGCCT
CGTGTGGCGCCGTCTCGGCGTTGGCCTTGGCGTATCGAGCCACCAGGTCCTCCTGCAGAGGACGCAACTGAGGCGCGCAGTGCAAACACGCTCGCTGAGG
GATGGACGGGTCGTAGCCCCTGGCGCCTTCGATCTGGTCTCCGTCCGGGATCAGCAGCAGCAGCGGCGAGCAGGTGCCACACACGAAGCGACCACAAGCA
CGACTGCATCAATAGACAGACCACACAACCGTTAATATCCACCGCAGTGTGGAAGCACTCCTCAGCAGCAGAACGTACCATTGATGACGACGTTTAGTGA
CGTCGAAGGCCAAGCCGCAGATATCGCAGTTGGGGTGGTCCGAGTATCGGCCCTTGAGGACACC