Description :
From Genome Similarity Track
Location :
Scaffold_773:9247- 10360
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_773-fgenesh-gene-0.3Resistance-Nodulation-Cell Division (RND) superfamily

Sequence
1113 bases(100 bases per row)
GCGATCACGTCTTCAATCGTTGAGAAATTGATTTGGGACGGCGACCCGATCGAGTCGAACCGGTACGACCCCATCTCGCGCAGCAAGTCGCTGCCGCTCG
AGCAATTGTTCCGCGCCGAGTCGCACAGCAGCGACGCGAACGCCGTGTCGGCCTCGCAGTAGTCGAACACATCGCGGACCACGTCGCTGCCGACGTAGTA
CGTGGCCTCTTCGATCGCGGGGAAGATCTCGCCGGCGTGCTCGGCGTCGCCCTCGATCAGCCGCACCTGGTTCACCTCGATGAACATGCTGTTGTTCGGG
CTGCACGTGAACTGGCACCACATGTGGCGCAGGTTCTGCTGGCACGTCGGACACAGACCCGGCAGCTGCCGGATCTGCGTCGACAGCACCTCATACTGTC
CTTCCGTGCAGCATAGCAGCTCCTGGCCGTCGTCCGCCGCGAGCTCTTGATACAACAGCGGGCAGTCGGCCTGGAACTTGTCTTGGTTCACGTCGGACCA
CTCGGAGAAGTTGTTGGCGTAGCCCTCGGCCGAGGCGTCGTCCACCGCGATTGGGTAGTACTGGCTCGGCAGGCCAGCCCCCGCGGTCGAGACGTTGACG
TACGCGGCGTCGAACGCGACGCAGTAACCCGGCGCCTGCCTGTACGTGCCGAGTGCCGTGATGGCCGTCACGTTCGACAGGCATTGGTCCGAGTCGGCGT
ACTTGCAGGTCGTGAGCTGCTGCTCGATGGTCGCCGTGCTGCCGGCGAGGTTACTCAGTACCCTCTCCTGGCTGTCCTTGCGTAACCCGCCGCCCACCAT
GACGCTGTTGATGATGGGCAGCATGGTGAGCGCCAGCAGCGCCATGGACCACGCCTGGTGCGGGTACACGCCGCTGCCGGCGATCTCGCTCGTCGTCGCC
TTGACCTGCAGCAGCACGGCCGGCGCGCGGCCGCGGCACCAGTTGACGCGCGGGACGCCACCATGATCAGCCGCCGCCGACCGCGGGGATCGCCTTGCGA
GCCATCTTCGGCAGTCGGAGGCGATCGCGAGCGCGAGGATGACCGAGAGGAACACCGCCCAGAAGCGCAGGTAGGTGAAGAAGACGATGGAGAGCTCGGC
GAAGAGCGCCTCG