Description :
From Genome Similarity Track
Location :
Scaffold_581:9244- 10760
Sequence
1516 bases(100 bases per row)
TTCCATTTTCCATTGCTGTCCAGATCCATGAGCCACTCGACTGTAAAAACATTGGGTCTGAGGGCAAGAATTTTGTTCCGATCAGCGAATAGTGTAGTTT
GCAAACACCGTAAGGATTCCGAAGTTCGTACACGAGCGGCTGCCACATATATGTGCTCGAATTGCCAAGCCGGCGCGTTTTCCGAACCTTCTAACAAAGC
AATGACGCGGTCGAATGTGCTTCCCTGGGCTTTCCACACTGTTAACGATAAGGCCATATCGACCGCATGCTGCTCGTACCGTATCGGTTTTCCATCTTTT
CCAAAGTCATCCAGCTTGATCGTGAAATTCTCACCATTTGATTGCACAACCCCTATTGGAATTACTACATACTTCTTATGCATCCGCTGCCCACTTGCAT
CGTATGTCCATGAAGACTCAAGGTTTGGATCGTTAGGCCAGCGGGAACCATCTAGCAAATTCCCATCGCGATCTGTTACGCGCACATTTATAAACTCAGG
TGCTGTGGGTAAATCAACCATCGATTTTCCACATCGCAGTGCTTCTTCGGTTAAACGCATCGCAGCGGATACTAATTCATCATCATCCCATCGCATGATA
CCAGCACCGCCATCCGTTGGCGACACCCAGGGTGGCATTCCCGTTAGCATAATCTAGGATTTGACCCGGTGCTCCATAATAGAAATATCCAAAAAAACTC
TGGGTGCTCTGCTTCATTGTACAACAATTCCTGAATAAAGTCAAGAATGTCGtcgaggggggggggggctttCGCCATCGATATAACAAATTTTGACTGC
GGCGAGCCAATTCCGTTGCCATACAGGTGTTTAGTACTGCTCTATCAACGTTACTAGTAACCAGTATGACAGATCCATCCATCCAGCTCTCATCGTCGAC
GGTATCTTGTCTTGTTAATGGTCGTGTTAGCGCAGCAATCATACTTTTATCAACCGGACGATAAGacgcgtcgtcttcgttccACCGGTTCTGCTCGGGG
TAGACACTAGGCATTCTGCGAAATCGCTCGAGATGTGTTATGTTTGCACAGCGAATCATAAATAATACAGCAGTATAACGTACCAGCAAAATCGATTTAC
CCCCAAAGGGTCTATTGCTATCGTACATCCCTCGAAGCCGTTCATCTAGCAAAACCAGGTGCTTAGCCTTGAACATGGAGATTTCATCAACTACAACAAG
TGCAACGTTTGGGCCAAAATGTTGGCTCAAGAATGCGGCCGAATGTGCTGATAATCAGTTACCCTTTTTGCTGCACTTTAGAGCAGGATGAAAAGTTCTC
CCTTTTATTAATTTGcatgctccagcaccagtcgGGCATGTGGATACAACTTCATATCGGCGCTGCTTCGTAAATGCGCCGTACTACAAACGACTTTCCG
GTACCCCCGCCACCATGCATTACAGTAAGTGTTTGTCCTTTTCCGCCTCGGTCGATACCGTCAAGAATCGTTTTCACGACTGTAAGCTGCTCTTTAGACA
ATTCACTGGAATCAAT