Description :
From Genome Similarity Track
Location :
Scaffold_802:9244- 10559
Sequence
1315 bases(100 bases per row)
GTCGGAAGAAGACCAAGCTGGATTCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTATATCGCCACCAAGCTATACGCGACTTCCTGCATCAAGAT
CCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGGGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATC
TATTATGTTTGCTTACGGAGTCAGGCATCGTAGCTGGGGTGTTCGAAGCAGAGGACATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGA
CCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCGTCGCCGAGGATCAGCCAAGCTGCGTCCTCAAACTACGAA
TCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAG
GACAGGAAGCCCCGGTGAACGTGAAAGCTCGGGATCCAGTACGCCCTACGCGTGATTTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCC
AGTGGGATTATCGTCAGATCAGGCTCGAGGTAATCGCCTCACGGATCCAGTCCCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGC
ACCCTGCAGCGGCACTTTGAAGCTGCGATGAATCGCTTCCTGGCCGAACAGGGTATGAGAGCGCCCGGGCCACAAGTACAAGTGCACCACGAACATGGAG
CACGGGACGTGGAGATGGAGTCAGTAGAGGGGAACAACTCCCATGATGAGTTCGACCCAGACGATCTGGATGGCCCATCCACTTCGGCAGCCGTGGTAGC
AACGGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCTATATCGGACTTGAAGGAGTTCACGGGCAAGGATCAAGATGAG
GACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCGG
GGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCAACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTAGGAGT
GTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGTTGGAATATCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTG
AAGATCAAGGATGGG