Description :
From Genome Similarity Track
Location :
Scaffold_258:92403- 94664
Sequence
2261 bases(100 bases per row)
GATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATCGATC
TCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGCCCTTCGCCAACC
ATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCTGGATTACGGTCGG
CACCCATTTATCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACCTTAACCGATCTGGCAGTTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTC
TTATCCGCCCTTATGATCCTCATCTTCGCCCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTA
GATCCAACCTCACTCCGGCCGGTACCATAAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTTCAACCCAAATGTCAAACCAATACACCAAACA
ACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGTCTTCACCAATCCCAACCTCAGTCTTGGATCCGACTCCCATCCACTTGGCA
CCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTG
GCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCTAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCATTAGATCCACGGGATC
CAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTCTCCCAATAACCACGTGCCTC
TCCCCTTTGTAGATACAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATTCACTTGGCGCAAACTAGAGATCTTGGCAGCTGACACTTCATGTAGATCA
CGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTAGCTAGAACGCTCGGCTCGTACCG
GATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCCGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTG
TAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACT
TCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGA
TCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGG
TAATCTTCAGGGTCGGAGTCCGAGCCGTCGGATCCTGACTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCG
GAGCCTTTTGGCGATACTTGCCGGACCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGTACTTCTTCAAGTTCGTCTGCGTC
GGGAAGTCGTAGCAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCC
TTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAACGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTG
CCACCGACACTCCTAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTTGATCTGCCCAGCTGCCGATACCAGTTCCT
GGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTC
GCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAAGTCCGATATAGCTGAGATCC