Description :
From Genome Similarity Track
Location :
Scaffold_190:9240- 14332
Transcript NameFunction/comments
Physo_124977reverse transcriptase

Sequence
5092 bases(100 bases per row)
TTCGGGCGCTGCTGTTAACAGCAGCGCTCGCATTACGTTCCAGTGTGCAGCGCATGGTGGGCTTCGTACGCCCTCACCATGTCCGGGACGCCTTCGAGCA
AGACGTTCCGCGGCTCCCATGTATCTTGGTTGGGAGGGAATCCTCTCCAACGGATACGAAAACGAACCGGTTGCCTGTTCGTTCTCGGGATACTGTGACC
AACAATCCGCTCAACTATCCATCGAGTTGAGCCGTGTGCGTCACGAATTGGCGGTGGTGGTGGTGGGAACACGCCCCGTGTGTGGTCAACTTGGTGTCGA
CCCTGATCTCGCGTCTCCCCACGACCGAGTTCCGGTCGTGGAGTAGTTCCAGAGCACTGCGTTCGGCGCTCTAAAGTATTCGCAGTTTGCGGCGGCCTCC
CAGACCGCCTCGATCGTTCCGGCCGAGCTGGACCATTAGCTCGACCCGCTGCTCCAGCGCGAAGTCGTGCTGGAGAGGACGATGGCTTCCGCCGAGTCTT
CTGCTTCGGTTCAACCGAGCTAGGTAGCTCGTGCTGCAGGTATGGCTTCAGCCTTCCGACGTAGAACGTTGGATGGAGGCGCATACTAGATGGTATGTCC
AGTGTGTAGGCGTTGCCGTGCCGTGCCAGCACAGTGAACGGTCCGATGAAGCGCGGAGCGAACTTGCTCGCCCCGAAGTCGGAAACGGCATGTTTAGGCA
GGTTTTGAGTAGCTAACAAGACTAATGAACCCTTCTCGAATTCATTAGTGTTGCCCCTGCCAACATTGTCTGCGTTCAACTTCTGTCGGTCGACAGAAGC
TGCAATAGCGTCCTGGACAAACCGAATGACGGCTTGTCTGCGCTGTACGAAGTGAATTGCGTCCGAGCTGAACTCGTTCAGCTCGCTTCCAGCAGTAGGC
CCTGCCTCTGCGTTGGTCTTCGTGGTGTTTGTGCCCTGCACAGACCCGTTCTTCTTCTTCTTTTTGCTCTTGTCGGCGTCTGTGCCCTGCACAAACGCGC
GGTTCTCGGCTTTGCTTTGTGTCGTTGCGGCTGACACTGTACAAGTGTTAGAGGCATTCTGCGGCTGCTGTGTTGGAGTCGTAGATCCCCCCCCCACTTA
AGGAAGGAGCCACCATCCCGAGTAGACTCGGGACGCGTGGGTGCCTGATGGCATTCACGTAGAACGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTT
GATGGCGAACTCCGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGCTCGGTC
TGCCCGTCCGTCTGCGGATGGTCCGCAGTCGACATCGAAAGTTGCCTCCCAAGAAGTGTAAACACTTCTTGCCAGAGGTGTGCAGTGAAGCGCGGGTCTC
GATCCGACACAATGTCGATCGGTATGCCATGGTGTTTGAACACCATGTCAACGAACAGACGCGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACTGCAGC
AAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGAC
TGCCAACACTCCCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGC
GCACCCATTTGTACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTC
ATACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGACAACACGGTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCACCCGG
TAACGGTGTGCACAAGCACGAAGATGTTTCGGCAGCTTCTGACGAGCTTGGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTCGCGTCCGCGTCGT
GCGCGTACGCGACCTTCACGTCGTCCAACAGTGACGACATTGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTC
AGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATC
CGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAACGACGCGTGGTCCGTATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCG
CGAGTGCGTACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACG
ACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATC
GGCGCCTCAGTCAAGCCCTGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAATCCACTCGACGTCCTTCTTCAGGAGCTGTGACAGCGGGC
GTATCATGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATT
GATCACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGACCACGGGTATCTCGCTCGCCCCGAAGATGCACATGAGCGCA
AGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATTCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGT
CGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCT
CGGCGTGCTCACTGCCGTGAGAGGGATATCGCTCTCACGCATGAGGGTCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCC
ATCGAATCGATGATAACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTATACGCATGAACGATGCGCCAGCCGCCCT
GTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGATTTTGATTCCCGCACTTGTCCAGCTTTGCGACGACTTTCGAAAAAGCCGTCGATCGCTTT
GACCTGCTCTCGCGGCAGTGGCCACTGCCTCGTGACACAGTACTTCGTGCCCGGCACGAGATCAATCTCGTGCTGGATTCCCTTGTCCTGCGGAAGCTCC
GCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGACTCGTTTTCAACGAGTCCCAGCTCTGCTCTTCAAAGCGCTCCT
TCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGGTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGA
GAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGATGCTTGTGTCGGA
GGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTCTCAGCCTCCGTCTGCCCGG
CAGACATTCCTTGTAGCGTCTCGGCCCCAGGCCGAGACATGCGCAGCGATCTTCGCATGCGCCGTCTTCTTGTTTTGCGGAGCCCGGCTCCGCTTGGTTC
TCGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTTAGTACCGCCGGCGGGTTCATCCCGCGGGCGAGCGACTCCAAGCCCGGCTTGGTCGCCC
GGCGCTTCGTCGTGCAGCCCGGCTGCACGATAGCATGCAAGTTTTTCCGGTGCGGAACGTTTGCAACCGTCCGCACCGCCTGCAGCGTCGGCTCCCGGAG
CCGACACGCCATCTTCACCTCGACGCCAACCATTGGCAGAGACCCCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCACCCAATCC
ATCGACTCCCGGAGTCGACGGCGTTTCGTCACTTTGGCTCTTAATATTGGCCAGACCTGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGAGGCGTGT
GACTTGCCTGCGTCATCCGTGCCCCTTGAGGCCGGAGACTCTTCCTGATTCGCTGAAAAGCGGGTGTCGATCTCCGAGATCAACATATTTTCTCCTTCAG
CCGTCGGCGGCGACGCCGACGCTTGCTGCTCTTGCGCGTGTGCTCGCGCGCGCCCAGGGCGCTCCTGGACAGCGGCATTAGGCGCTGTCCTGACTGGAGA
GTCGCGCGCACCTGTCGGTGCGTGCGTTGCGGCAACAGGTCCATCGCTCTCTGTTCCGCTATCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCG
ATGACCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAACTTATCGTCCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGATCTT
CATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACCTCCAACATACTTCGAGGTATCTTTACCTCCTC
GAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTGTTCGACGCGCCAGAATCTACCAAAGCACGGAGAGAGCCGCTTGCTCTCATCGAGTTCACA
TTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGGATGAACCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACAC
GCGGAACTGCATTACCAGTAGGGCGCCCCGCGCCTACTGGGTTCCAGCGTTTTTTGTTTGTCCGCGACGTTGCCCGGCATCGCCGCGTCGAC