Description :
From Genome Similarity Track
Location :
Scaffold_1497:924- 3569
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1497-snap-gene-0.1Lysosomal alpha-mannosidase

Sequence
2645 bases(100 bases per row)
GTGTACTTCCGCCGACGGGTGTGCCAACGGGATCGAGATTGTCTCAATACTCTTTCGAGCAAGTGCATTGTGAACGAGAACCTCAAAATCCTGCATACCC
AGACATCCACAGTCAGCACTATTGGTTGTACAAACCCGTTTCAACCACATACCTCGTTTTGCGTCGACACGTCACAGACGCTCGTGTTCGCCAGCAGGCA
GAAGTGATACGGCTCCTTCGCGCCAATCACGAACAGGATCTCGTTCAGTCCCTTCTCGGCCGCGACGATACCATCGTTCAGACGGAGTGCGTAGTCATTC
GAGACGGCTTGCTTCTCGGTGCCCGACAGGCCGTCGTGGTGCTGCACCAGTCCAATAGCGCGTTCAAGTGCATCGAGCTCGGCAGTGTGGTGGCTCTGGT
ACACAGCATCGATCTGACGAACTTGCTGCAGCAGAATGTTCGAGACGCGAGCGAATCGCTTGAGAGTCGGGCGGCTCGTGAAGAACCCCGACCAGTACTC
GTGCTGAGCTGAGCCATACGGGAAGAAGTCGTCGGTCTTGACGGCCCATGTGAGGTTCTCGGCGCGCTTGAGGTCTGTGTAGTAAGACAAGTTGGAGTAG
AGCACATTGACGCGGTCATCTTGGTTGATGTAATGCTGTGGTGGTCACCAGAAAGGTATCGTTAGTCAACTCGGCATCACTCTTGCAATACTCTCCTAGC
AGATGCGCACTTACGATCAGCTTATCCATGTTCTTGTACCAGCGGCGCGCATCGTGATAGGTGAAGTCACCGCCCATAGGGATGAAGACGTGGTGGCCCT
TGGATGCCGAGCCACGCATTTGAGCGTTCTGGACAAACGCATCCACCTGGTCGCACACGTTGAAGTCGTGCAGCGCCGGATCATCCTGTACCCAGTTGCC
GCGATTGCTGTAGTCGAACTTGCCAGGCGGGCCGTAGTGATCAATAATCTCTCCCGTGAACACTTGCGAATACTTCCCACGTGACTTGCTCGGACGCCAA
ATGAACTCCAAATTCTTCGACCGCTTCCGAGTGTCGTAGTCCTGATAGTCGATCCGAGCGAAGTACAAAGCGTCAAAACCCACACCCTCAGACAACAGTG
ACCCCTGAGTCGCCGAGTGACCGAATGGGTCGATCTGCCACCCGATGCGAGGTGTGATGCCGAACTCGTCCATCAGCAGCTGATGGCCGTATGCTGTCTG
GTCCACCATCGCTGAGTAGTGCGGCGTCGCCTCGTCGTGCATACACCATCCTCCGTTGACGGACAAGTCGAGTCTTCCTTCCTTGACCAGTTGCTTGGTG
ATGGCCTTGACATCCTCGCTCTGCTGATGCCACCATCGCTGAAAGAAGGACTGTCACAATCAAAGCACGTTGTTAAATACCCATTTTGGTGTCGGCAGTG
CGCTGTAAGATCGTCATGGTAGACAACTATGCAGGGTACGCTCTCACCTGCTCGACGAACATGAACTTGCNNNNNNNNNNCACGCTCTCCATGTAGTACT
GGTCCACCGTAATGAGCCATCCCCTGCCGACATTCACGAGCGTTCGCCGTCACCCCTTCGTTACCACAACTCCAGTGCCTCCCCCCCCACACCCAAGCTG
GCCACTTACGGATCGTCGTGCGAGTGAGGGATCAGGTGTACGTTCAACTTGTCGGCGATGACCTTGCCCTCGGTGTTGTAGCGACCGTCCACTGGCAGCT
TCCACTTGCTTGGGTCGCAGGGGCCAGTGACATTTGTAGTGACCGGTCGTGCGTAAGCTCCAGGTACCGCAGCGGCCGCGAGGGCCGCCACGACCATCGA
AGCCCAGGTCGAGACGCGCATCGTGCGGTGACGGCAGCTTTCCTGATTTGCGATCGCTTCTCCTCTCACTTCAACGGAGGAGGATTTGATGGATCGATTC
AAATTTGAATTGCTCAGCTGGAGCTTCAATTTGAATATGTACGGTATCCTTCACACTTCAACATGGACGATGCAGCAGCGAGCGCAGCGCAGTGGTTTTG
ATTTTGTGCACAAACCGAACGATTATTCATTCGGTTGTCGCCAACAAGACCGAGTGGATTAGCCTAGCCACATGTGTTGCTAGTGACATGCATGGGTCTG
CTCCTCGGCAAAGGTGAAATCTCCCATTGTAGCTGCAGACTACAAATCAAACATAACTGCGGGAGTGACCATGCGAGCTGTTCAAAGTCTAGAAGGAGCA
AAAAACGCAATGATGTCTCATCGCCTATATTGCGCCTCTGCCAATGTTGTCCATCGGCAAAAACACAAACACCAATCCAGAAGGGGTTTCTAAAGAGATG
AAGCATTCAGACGAAACATCTGTAGCTTCCACTGCAGCAACTCCACCCCGACAAAGATGTATTTGATGGTTAAAGACATACTAATCTCGTCGGTCGCGAG
AGGCAATTCGCCTTCTCGTCCGGGTCTCAACTGAGCACGCCAGCGAACGTCTGATGCGTACACACTACGCGACAGCCAGGAGCTCGTCCATTGCCACAGG
AGCGCTGTTCTGCACTGCCGTTTCCTCAGCATCGTCGATGTCGTTGTCGTCGCGGAGTCTAGCCCACTCCAACGACTTTAGCACGCTATACATATCCTCC
ACATCCTCCGCATCCTCCACATCCTCGCCCTTGCCGAAACACACG