Description :
From Genome Similarity Track
Location :
contig_66:92386- 93833
Transcript NameFunction/comments
g9576.t1hypothetical protein

Sequence
1447 bases(100 bases per row)
TCGTGGACGGCCGTGTAGTTGTAGTACACCTCGTTCTCGTACTCGCTGTCGCAGTACGGGAACGGCACGTCCGAGGTGGTCGGCGCGAACAGTGCCTTGC
CAGACGTGTACGTTACGTAGCAGCCGAGGAAGCTGCAGATGACGACAACAAACAACGCAGGGACTTTCTCCCACATCGGGATTTCGTTCCAAAGCTTCGT
GAGCAGGAAGATAATGGGCAACAAAATGCTGATCAGCGTGATACACGAAGCGCCAACGAAATCCAAAAAGTCGGAAAAATGGTCGCGGAAGATGATCGAG
ATAACCACCAGGATCACCAGGATAACGACACGGAGGATAACGTACTTGATCGCGTTTGCGCCGGTATTCGGCAGCCTCTGCCTCAATGTCGTCAAGGTAC
GGGTTTTCGGCGTCAGCGTTTGAGATGTACGACATCTTGGACGAGAGGCGGCCGTCGCTGTCCTTACTGGGCGTGTTTGCTGCGCCGTACATCAGAGCAT
TTTCCACATCATCTTCCTTCTTTTGGTGCATCTTGAGAATCAGGCGCTCGGCAAGGTAGAATGGCGGGTTCAGGATGACGGAGAAGGCGATCGTAATGTG
CAGCTGCATGGAAAAGTAGGCCATGACGACGGCGCCCCAGTTCGACTTGAAGCCCAGCGTGGTGAGGCCGCTCGTCGAGTCCGGGTAGATGGAGAACAAG
ATGTTGCCCGTGATCTGGCAACCCACGGCCGAGTACGCCGTGCTGGCCAGGATCAGGAACAGGCACGAGATGAAGCCCATGGTGACAAAAACAACCACGC
GGGCATGCGTGTCGGCTCACTGTGCTGGCGCTGTAGGGCCGGAATTACAATACCCGCGTTGTACGCGACTGCCAGGTTGCCGAACATGCCCACGACCTGC
GAGAACTTGATATCGGGTGACGGCGCAGACGGGTGGCCGCGCATGCCGTACATGACGACGGCTACGCCAATAATCGGCGATGATCGTGCCCGCGCAACCG
GCGAAAGCGACCCCAGCACCTTCCTTGAGCGTCGGGATGAGGCAAACGGGCAGGCACAGGAGCGCCATGAAGCAGATCCAGTAGGTGGTGCTGAAGGCAT
CCGGGAAGAGGCCGTCGAGCAAGGTGCCGCCCAGCACAAGTAGCACACACGGGCCTAGCAGACACGAGGCCATCTGCGAAACGACTGCAACCAGTGTCCC
CACTTGCCCATGCACCACTCGCCTAGGTCGCTGTAGGTCTTGACACTCTTAGGTGCCAACAGCATGACGCGGCAGATGGCAACGGAGGAGTAGACGTTGG
CGAAGGCCATGAACGCTAGACCGACGATCCCTAGCACGGGGCCAGCGCGTGAGAAGTTGCCAGGCATGCCAAGTGTACCAATGCCGTAGACGCAGCAGAA
GATGTTTAGAGCGATCTTGAGGTCCTCCGTCGTAAAGAACCTTTTGC