Description :
From Genome Similarity Track
Location :
Scaffold_85:92357- 94903
Transcript NameFunction/comments
g5274.t1XP_009515156.1 hypothetical protein PHYSODRAFT_358351 [Phytophthora sojae
g5275.t1hypothetical protein

Sequence
2546 bases(100 bases per row)
GCCGTTGGCGCTCTCACCGAGGCATGACAGCACGGGGATCTCACCAGCGTCGATGGCCGCCTGAACAGCCTCGCCGTGGATCTTGTTCACCTCACCCACG
AAGCCGTAGACGTCCTTATCCTTGAAGTCGGCCTGGATGACGCCGCTTGTGATGCCGCGCGCAGGCACGCCGGCCTTGTTGAGCGCGGCTACGAGCGTAG
CGTTCGTGTCAATGAAGATCTTCTGGGCGATGTCCAGCGTCTTCTGGTCCGTGACGCGGTTACCGCCGACGTACTGGGGCTCGACGCCCTGCTTGTCCAG
TTCGGCGTTCATCTGCGGGCCGGCGCCGTGCACGAGAATGGGGAACAGGCCCGTATCCTTCATGAAGCGCAGTGACTCGATGAGGGTCTGCAGCTCGTTG
ATGATCACCTCGCCGCCGATCTTGATCACGGTCGTGTGGTTCACGCCAGGTGTGCGGTACAGCTGCTTGAACTCCTCCAGCGTGGCCTCCGGGGCCAGCA
CCTTGGCCAGGTTCAGCGCGTAGTCGTCGGACGACGAGGCCGACGAGAGCGAGCGGCGGCTGGCAGTCTGGATCCCTCCGGCGGCGAGCTGGGCCGCGCA
CGCACGGGACGCAGCAGCAGCAACGGGCATTGTCGCCGCCTGCGAGCTGCGCGCCGCAGCGCGGGTCAGCGCCGGCATCTGCTTGGCCACGGAGCGCAAC
ATACTTGGAAGATCGCACTGGAGAGGACTCTTTGGTTGTGCGGCGGCGGCGTACGTAACCCCGAGCCGGCGGTTGAGCACCTGTCTAAAGCGATAGGCGT
TCTATTGAGTGCTAAAACGGAATTAGCAGTGTAGTAAGGGTAGTACTGAGCAATGTAGCCATTTTCATAGTAAAGCTGAATTTAAAACGTTATCCAATCA
TCGTTGAGAATGAAGTATTAGGTTCGGATTCGAAATGGCAGACGGCACCGAACTTAAGCTGACGCCCATCTCGCCCGGTAGTCAAACAGGCAGCGCAGCC
AGTTAAATGCTCGGATGGCCGCTGATTGGCTGGAATAGGTGCGCGGTCGGCACGCCAACGGCCCGACCGCGTACTTTGGATCAGCTGCGATCCCACTCTG
TCCGGCTCGAATGGGTGGCGCGAGGACGCGCCTCTCAACATCATGATGATGAGGCTCCGCGCTGGGCACGGGCTATGGCGCAGGTGAACGTTCTCCTGGC
CGTTAGAGTGCGTGGAAACTTGCGCTTCGCTCTGCCAATGCCGTCAGGCTCGGAGCGTGTCGCGTGCATCGAATGAAAGCTCATTGCCCGAGAATGGCGA
AGAAGCCGGTTGTCGCGGCGGTGGGGGTTCCCGATATGAGCTCATCGAGGTGGCAATCATTCAACATGCGCGCTCGGGTTCGGCCGTTCTTTATTGCCTC
GTGACGGCGCATGCTCGCAAGTTGAAGTGTGTTCGGGCATGGTCAAGCGGCTGCACTGCAGTAGAGTGCAGAAACACCGGTTGCAGATAAGCTAAAGTAA
ATGGCGCTCGACTCGTCGCAGCCAGTGAACCGTGACCAATGATCCCAAACGCCACAGTCGGAAGAGGTCAAGACTTGACCTGCTTCAGCCAAGCGCTCCA
GCGGAGCCCAGGGCTCGTTTTTGTGGTGTACATAATCTGTGTGGTGCTCCGAGCCCGGCTCTGCCCTTGATTTATGCATGTCGAGCTCCGCTGCGCACGG
GATCCGCAACAGGCGCTCCGCAGCTGGCGGATTCTATGCACGGGCGGCCACGTACCAGCGCGATCTTGGCTGGCCGCCGCTTCGGATCCGAGTGCGGAAT
GCCATTTCCCAACTGGAAGCGTCGCGGACAAGAGCCTCTCTCGGCCCTCCACGCGCTCGCCCCCCTCCATCTGACAGGATGCTTCGCCTGTCGCACTCGG
TGAAGCGCCGCGCGCCACTGTACAAGGCCAGCGGCAACCGCCTGCTCGTGTCCGCGCGCGAGAAGGTGGACCGCCGCAATGTGCCGCGCTTCGAGACGCC
CGCCGTGCTCGAGTTCGAAGATGGCACGCGCTTCCACGGCGTGTCCTTTGGCGCCAAGAAATCCATGGCCGGCGAGGTGGTCTTCACCACAGGCATGGTG
GGCTACCCGGAGGCGCTCACGGACCCGTCGTTCAAGGGTCAGCTCCTCAACATGACATTCCCCATGATCGGCAACTACGGCGTACCCGACACCAAGGCGC
TGGACCAGTATGGTCTCAACAAGTACATCGAGTCCGACCGCATCCACGCCGCGGGTATGATCGTGCAGGACTACTCCAACCACTACAGCCACTGGAACGC
CGCGCAGTCGCTCTCCGAGTGGCTCGAGAGCGAGGGCATCCCCGGTATTGCCGGCATTGACACCCGCGCCATCACTAAAAAGATCCGCGCGCACGGCGCC
ATGGCCGGCCGCATCCTCGTCGAGGGCAGCGACAAGCCCAAACTCGTCGACGTGAACGAGGCCAACCTGGCATCCCTCGTATCCACCAAGGACGTGATCA
CGTATGGCAAGGGCAACCCACTCAAGATCTTGGCCGTCGACTGCGG