Description :
From Genome Similarity Track
Location :
Scaffold_736:9234- 13288
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_736-snap-gene-0.9Formin-homology 2 domain-containing protein

Sequence
4054 bases(100 bases per row)
CAGGGCCGGACTGGTTTAAAGTACGGTATTGTATATATCCGGTCACTTGGCGTGTCGACGCCTGTCCGTCGACTGCACAGCGGAAATGGCTGGCCATGGC
CGGCATTTGGCGGACGCCAGTGGCCGTTGGCTTCGCCCGCTGTTTCATGTATGTCATGTTGCGCGCACTGCTGCGGCTCGCGATCTTGGTGCCGCCGCCG
CATGTAAAATCGTGGTTTCCAAAGCGACGCGGTGTTGTTGTTCCCACTCCTTACGGAAAAGAGTGCGTGTGCAATCGTAATTCTGCGCGCAGTGTTTGAC
ACGTTTTACAGAAAGGAATCTCTCTCGGTCAGGAAAGACAGAGAGAGTGTTGCGGATTGTATGTAGTGGAGTGTGTGAGTAAGTTGCGGTGACACGGCGG
ACGAGTGCGTGGCTTGTTGAAGACGGCCTCGCCGAAGCAGCGTGACGCCGGCTTGCCACCGCCTCGCTCCAAAATTCGAGCCCTGTTTGTCTCTGCCTTT
CTTCCTCGGTAGCCGCCAAACGTCGCGGAGCCACACCACCAAATCCAAAAATCGAGAAAAAATCGAGCGTCGCCCGCTTTTTGTGGCGTTTTCTCGCTGG
TTGGCATCTGGCTCCATTTCGCTCCAGTGCCGTTTGGTTTTTCGGCTTTTTGTTGCCGGAAAGCGGCGCTTTGTAGGATGGAAAACACACTAACCAACCA
GATCAGACGGCAAAAAAAAGAGCGCGTGGCATACTTTTCGCAAGTCAAAAGCACTATGTAATGGACTTGATCGCGAGCCACGCTGTGCGGTTCCGCCCAC
TGTGGCTGCCGATGACGTAAAACCTCGAGGTTTTTCCCACGCCGCGCAATTGCAGCTCATCTTCTTCCGCTGCTAGAGGGTCCCCATTCGTCACTGTATA
ACCAAAACAGGGGGCCGCCACTTGCCCTTGCTCTACGCGGCCGCTGAAGTTCCCGGCCCCCATGTGAAGCGCAGATAAAAACGCGATTCCCTCGGCCGAG
AAGCTCGGCCGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAGAAGAAAAGGGAGGAGCAGCGGCGGCGGCCAGGCGCAG
GCGGCCCCGGCGCTCTTCCAAGCCGAGTCACGCGGCGGGCGGGCCACCCACACGAGGAGCGGGCCGGCCGCACCCACTCTTGGGTTTCCAAGCGCAGGTC
GGAAGGTCCGAGAGAAGCAGCAGCCCGAGGCGGTGGAGGCAGCCAGCCAGCCAGCCAGCCAGCGTCGGGCCATCGTCCCCGTCCCGGTCGGCCGCGGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTCGACGGCAGGGAGGAAGGGGAGGGAAGGAAGCAAGTTAGGAGAAGCAAGGAAGGGAGGCGGATCGCCCCGCGG
ACGAGAGCGGGGAGCGATGCCGTCCTTCATCTCGCAGCTCATGGCCAACAACGGCGACAAGGGCGGCGTGCTCAACACGAGCGGGCTGCCGACGCTCGGG
TCGCTGGCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCGGTACCGTGGTGGTTCCCGCGGCGTCGTCGGCGAACTCGACGCCCGCGTTCGGTCCG
GCGTCGGCCAGCGCGGCGCCGATGCTGCCGCACCTGNNNNNNNNNNCCATGATGGGTCGTCCCGCGCGGGGCGACTCGCTCAAGTTCGGGCTGCCGCTGC
CGCTGAACCTCGGCGCGAGCACGGCGGGTAACCCGATGGGCCTCTCGGGCGGCGGGATGCTCAAGCGGCCGCCGTCGTTCCGGCGGAAAAGCTCGCAGAG
CGGCGGCGACGGCGGTGGCATCGGCGCCATGGGAGCGTCGTCGACGTCGACCTCGACGCGGTCGGGCGGGCCGCCGTCCTCGGCGACGCCCTCGCCCTGG
AACAACAACCAGAAGATCCAGGACTTTTTCCTGCACATCACCGACATGGAGAAGGCCGCGCACGCCGAGCAAAAGATCATCGACATCCGCGAGCTGATCG
CGCGGAACGCTCCCGAGCAGCTTCCGCCGGTCATGCTGGACGAGCCGGCGCCGGAGGAGGAGCCGTCGCCGACGCCCCCCTCGGACGACAAGGCCGCGTT
CAAGAACGCGCTTTCGGGGATGCTCGCGGCTCGGCAGAGCGGCAGCGGACGGTCGACGCCGGCTCCGGATAACCAAGGCGGTGATCAGGAAGACAAGGCG
TCGGATGCCGCTGAGGAGAGTGAGTCCAAGTCGCGGGAGGACAAGCGCAACGCGCTCGCGAACATGCTGAACAAGCGGAACGGCGGGTCGGCGCCGGAGG
ACGGACGCAACGCGCTGATGGCGATGCTGGCGAAGCGAAATGGTCCCAGTGACGACGACGACGCAGCTGACGAGAGCGAATCGAAGGCGCCGCCGTCCCG
AGCGAACATGCTCTCGGAGATGCTGGCGCGAAGGGGTAAGCCCGCGGAGGAGACCACCTCTCCGGCAGAGAGCGATGCGGATGCTGGCAACCCGCTCGCT
CAAATGCTCGCCAAGCGGATGCAGTCGGCGCAGTCGGCCGGTGAGGCGTCGACCCCGAAGGCGGCCAACCCGCTTGAGGCGATGCTGCGCCGTCAGCAGG
CCGCCAGCAGCGATGACGCGGCTTCGCAAGATGACAGTGCCGAGGAGAAGAACGGCGTCCCATTGAAGGACGATCCGGAGTTCCAGCAGTACTTCAAGAT
GCTCAAGATTGGTCACCCGCGAGAGGTTGTGAAGCACAAGATGCAGCGAGACGGCAAAGACCCATCGATCTTGGACTGCGACCCCACGAAGCCGCTGCCA
AAGCCGTCGACCCCTGCGTCGAGCGAAGGGTCCGAGGACGAGGACATTGAGGCCGAGTACCAGGCGCAGCTGAAGGAGTACAATGAGAAGCACGGCAAGT
ACACGCAGATGCTGAAAGTGGGTCTGCCGCCGACAGTGGTGCAGCACAAGATGCGCATGGACGGCGTGGACCCTAGCTGGCTCAACGGTCCGCCGAAGCG
GCGATCTCATGCGAGTCAGACCGTGTCCGCCGCGCCGACTGAGGCCGAGATCGAGGCTCACAAGCAAAAGTACGACAAGTTCTTCAAGATGCTGCGCATG
GGGTTGCCGCGCGGCGCCGTCGAGCAGAAGATGCGGATGGCTGGAGTCGACCCGAAGGAGCTGGACGGGCCGCGCCGACCATCGTCGTCTGCTGGCGCTT
CGACCGCAGCGACGCCGCAGAAGCCGGTGCTGAAGCGACAGGAGTCGATCCGCAAGAAGCTTCACTGGGAGGTGAAGACGCACGACTCGGACGCGCCTCG
TGACAGTTTGTGGGGACGGAACTCGTCGGATGAGTCGATCTACCGTGTCCGGATCTCGATCGAGAGCCAGGAGGAGCTGGAGAAGCTGTTCGTGAAGGAC
ATGACGGAGGCTAACAAGAAGAGCGACGCGGCTAGCGAGAACGGAGGCAAGTCCTCGCCGAAGATCAAGAAGAAGCCGATGGTGGCTCTCATTGACATGA
AGAAGTCGCAGAACATCGCCATCACGCTGGCTCGCGTGAAGATGAGCCACTCGCAGCTCAAGCGCGAGCTGCTGGCGATGAACCCGACCGTGCTGTCGAC
TGCTCAGCTGCAGTCTTTGATCGACATGTGGCCCGACAACAAGGAGGAGATTGCGATCAACAGGTACAAGGGCGACCTGTCGCTGCTCGGATCGGTAAGT
GGTGGTGCATTGCTCTGTTCACGGATGTCACTCGCAATGGTACTAATGAGTGTTTCTGTGTGTTAGGCTGAGAAATTTTTGTGGGAAGTCCGCAACATCC
CGCGGCTGAAGGAGAAACTGGGTTGCTTGATCTTCAAGCAGGAATTCCCTTCGCGCGTGCAAGAGCTCAAGTACGTCTCCTGTCGTGATGCAATTTGTGG
TTGGACGCAGAGGGGTTAATGGCTTGTGCTCGCCTTGCAGGGAAAATATCGACCTTGTGACGCGCGGCGTGCACCAAGTGTGCTCAAGTGAACAACTTCG
CCAAATATTTATTTATATTCTGCAGATCGGCAACCTGCTGAACTTTGGTGCCGA