Description :
From Genome Similarity Track
Location :
Scaffold_481:9234- 21108
Transcript NameFunction/comments
Phyag_g6062conserved hypothetical protein
Phyag_g6063hypothetical protein PHYSODRAFT_343759
Phyag_g6064endomembrane protein 70-like protein, putative
Phyag_g6065hypothetical protein PHYSODRAFT_343761
Phyag_g6066hypothetical protein PHYSODRAFT_248383

Sequence
11874 bases(100 bases per row)
CTGTGCATTGGCGTTTCCATTAGCGTTCTCACGACGCCTCTTGGCTTCCGCACCAACCCGCTTAAATTTCTTGCTCTCTGTTTTGTTCTGGCCGCGGTAC
TTTTGTTTATCCCAACGAGACATCTGCAAGGAATCTCggcatccagcaccaccttcccAATGACGAGAGGTCGACTTCTTTGCTGCAACATCATTGCCAC
ACGAACACACTTTCACCGCGCTTGATTGTTCCTTCGAGCACAACCCGCAAATCATTCGGCTGGCAAACTTTCCCAAGTTGGCTTCAGGACAGTCACTTGA
GTCATGGCACACGTCGCATGGGAAAGCTTTGCCGCAGCACTGGAACCTAAACCAGCGGAGTGAGTGCTTGTAGTGGTCGCACGCTCCGTTACGAGGCAAC
GGCTGGCCCAAAACGAATGTCTCCACGACTTGTTTGGCTCctttcttgctgctctttgTACTGGTAGGTTTCGTTGTACTATGGTCAGGCGAGTTAGACC
GCTTGTCACTTGACCCTTCCAGTTGACGTGCCATGAAGCGCTTTGCCATCACTGCCAGCTTGACATGGCAGGAAAAGCAGGCTTGCTCAGATCGTTGTCT
TGGACTtatcttctccagcaatgCTTCGCACCCGCACTCCAGACAATTGGCCAACATGTCGGAGGGAAGCACATCGACAATGTAGCAGTTTTCAGTGTCC
ACGTACGCTAACACGTTACTCTGTGAGTGGGCAAACACAGGCCTCATTAACACGTGGTGAAGCACACTGCACCGCGGACACCATTTCTGAATTTCTGCAG
AATCCAAGCTCAGGATGGCGTCAAACTTAAGCGGGCAGTTATCGCACTGGACTTGGCAAACAAGCCGATGAGCAACAAGCGTGCCGACTTCGTGCAGAAA
CAGATCTTCGAGGCAAATTTGAGTGCCCTTCACGTCTGGTTCGGTTTCAATGGCAACACGCTTGTCGGCTGGAATGATCCTGGAATTTCGAGTATGGTCC
TCGCTTTCAATTGACTCCGCTGGTTCCTCCTCGTTTTTCTCTTTTTCAAATATGATAGCGGTGGTAGGATCCACACCACGTCTCACAAGATCACACAACA
TCTTGAAGCGGTCAATACACTCGTTTAGAGACCGGCCATCGACATCGTTCGCTATGTTGGTCCATCTTTCTTTCTTGTCCATTGTCGCCGGATACTTTTT
CAAGGCCAGGTCCAAtgctcgctgctgcgcttccgaCCATTTGCTGATGGTGTCGCTCTGTGTGTCGATACTTTCGTTGATGGACCCCATTGAAGTGTTT
TCCACCGCGCTATTCTCCACTTCGCTTGCCGCTCCAACCAGAGTACCCAACTGCACGATAACAGCGCGCGGCTTTAGATCCGATCCTTGCTTCTGCCCCT
TGTCATTCGTTCTAGAACTCTTGACAGCATGAGAGAATTTGCACTTGTCTCCATCGCGACACTTGTTATGAGCGAAAAACTTGCATTTACGCACTCGGGT
TTTCTTCTTTGTTTCTGACGTTACCACAGACTTCTCCGCTTCCGATGGTTGTGCCGGGTCCGCTTCGCGTACCACCAACGTGCCATCTGTATCAAAAGCT
TCAGATCCATCGTCACcaatctccatcttcgtcgttgcCTGCCTTTTTTCGTGCGAAAACTTGCACTTCTCTCCATCCCTGCAATTACCTCTTGCGAAGA
AGCGACAAGCTCTCCGACCGCGTCTTCTCTTCGGTTCCTTCTCACTCGAAACCAGTATTTCCTCCTCAGCCACAGAaatctccagctcttcatccTGCAC
ACTACTGTCAATTGCCACCTCTTGTTCCTCCTCTAAGTCTTTCTCGAACGGCTCAATAATCCGCCAAAAGTTATTGTCGATCCAggtcagcagcttcctc
agcGAGTAGCCTCCGCACagctgctgagctcgagCGTTCACTGCATCGTTCAACGCGTCCACCTGTTCCTGTTCCAGCCGACTGATCCACTGTGTAAAAT
CCACCTGAGCTGCCTCCATCGGGTATTTCTGAGGCAGCGTCATCTGCAGTTCCACTTGGCCTCTGAGTCGCGTCGGCAGCTCTGGAGCCGACAGACTCAA
GAAGAGATGCACGTGTTTGCTCCGTGTCGCGGGGTCCTCGTGGCTCAGCTGCAGGTGATAGCGACGTTCCAGCGCCATCCATTCCTGCTTGGAGGCGTCC
GTCTCGCtcgccagcgtctcctgccAGCTCAATTCCGGCATCTTACCGTAGCTGCAAATTTGAAAATGTGACGGTGAAGCTGAGAATCGCGAATATTCGC
GTTACCGGAGCGAATATTCTGGGAACAGTCGAACGGTTAGCTAAAAAGCTGTAGCCATCACGCTCAACAAATGACCATGTGGAATGTTCGTCTCCGTGGG
CCTCGCGgcaagctggtggtgctcaagatTGACCCGGACGCCAGCTTCAAGACATTCTCAGGTGTGTAGATGGCATGATGTGCGCTGTTGGTAGCGTGGC
TCCTGTGACGCGATCGTTATGTGTGTCGTACAGAACTTACTGCCAAGGAATTGGGGTTGAACGCGAAAGACTCACCAACTTGTAAGATTTTCGCTGCTTG
GTTGCAATAATTGAGGTCAGCTGATGCTTATATTGTGATGTACTGCAGTTCGCCGAGGATTTCCGCCtcgagcagttgaagtggatgattCAGCGCTCGT
CAAGTCTGTCTTTGAGGCGAATGATacagtggtggtggacacgaactctggtgctgcagcggcagtgcAAGCGTCGGCTTCTGCTcctgcggccaagaag
actGCGGGGGGGCCAaagagagctgctgcaaagaaAGCGGCGCCGAAAGCGCCGAGAGGAGGGGTACGTACGTTGAATCCTCCGacaaaggagaagaaga
aggcgtcgcCCAAACGGAAAATCACTGGCAGTGGACACCAGCTTGGCAGTTCTCTGGAGAACGATCCATCTGAAGCTGTGGAGGCAATCGGCGACGATGG
ACAGGAACCACAACGCAAATATCGTCGCAGTCGAGCAATTAATCTGACGTCCAAGGAGGATGTGGAGATTAGTCTGCTGAACGCTGTTAGCGGCCGATCC
AAAGGTCGTGCAGCGAAGTTCTTCCGCGCTGCTACGAAGAATGCAGTGGAGCATCAGTATGAATTGAACTTAGCTACTGCTAGACTGAATGCGGCGTTGG
CGCATAATTTTGAGATTGAAGAGCTGTCGACGACCCGACGCGCTGACGGAAGCGCAGCTAAATTGCGTGTGCGCTTCAAGGAAACACCGCGCAAGTGGAA
GGAAGAGACTGTGGATCTACTGAAgacggacgagctgcaggccaTTTTGAAATATGTGTTGCTGTCCGGTGGCGAGACTGGGCGTGAAATGCTTAAGCCT
TTCAACATGGCGCAAGTGTCCACGAGAGTCTTTTGGGGTATTGCGCGCTTGTACGATGGAGATGTGGCTGCTGGTCTGGCGGATCTTGTACCCGATGAAG
ACTGGTCGTTCTTGGACGCTCGTACGCGGTACGTTTGGTGTGTTGGTTGTATGTAGGAAGCAATCTGTATTTGTTTGACCTGGATATCCGTATGATGCTG
GCGTCTGACAGCGTTATGTCCGAGAAGGCCATGGAAGCGAAGGTATATTCCGTTGTTGGGAGCCAAAACTTAGCAAGTATTTTGGTGCAGTTTGGTGATC
TGTGTGCTATCTCTCTGTGTCTGTCAATTACTAGGCAAATGAAGAACAATATAAGATGTGGAAACAAGGAGGCCAAGGTCGTGCTCGGGGTGCCCCGAAA
TCGTCTCCGACACCGGAGAGTAAGCCGGCGGCAAAGGCAGTTAAACGTTCTACAGCAAAGGAGCAGAAACCTGAGGTGATTCAAGTGGATTcaagtgatg
aagaagaagctaaGCAAGAGGCTGCACAACCCAAGCGTGAGCCAGCGACTCAGACACCTGCTCTTTTGGCTAAGGACGCGACTCCCAACACCCTCCGGAA
TGCAGCGGCACAAGCTGCACTATCCCGGTTCGACAAAAGTGCACAGACTAGCGCCGTTGTGTCTGCTTTTCTTCCCGATGACAAATCGGTTATGCAGGCC
ACTAAGAAAGAAACTGCAGTGGATGGAGAGGAAACAGagtccgaagaagaagtggaggaagcaACCACAGTTTACTGCGATTCCTGCAAAAAGGCACGCA
TTCTATCACCCGAGGAAGCAGCTAATGCCGACCTCGATAAGGATCCGTGGACCTGCGCCAACTTAGCGAAGACTGGGCGCAGCGGTGGATGCGACGGTAT
CGATGATGAGGTTGCTCAGATCACGGGCGCTCCAATTGCTGAATGGTTGCGGAAGGCTTCCATAACTACTCGGCGAGAACTGGCCGATGCTTCAGtgggc
tcgacgatgcatGCGCTTGTGAATCCGTTGGACCCGTCAGCTCAAACtttgaaggagaagctcgaaAAGCTTATCGATGAGGTAAGTAAGCTTGCTCTAA
GTCGTGTTGCGGATTACACCCTTAACGCTGTACATTTGTGACTAAACTAGGCGCGTCTTGATGAGGTGAACGACTGGATGGCGGAAATTGTAGGCGAGCC
AAAGGTGGTGCAACGACTGGAGGTTCAAAAGATGGGGACGCCTGCCGATCTGTTAACCACACCAAGTGATTTGatcctcgaagctgctggcaacGCCACC
AATGTATCTCTTGATCTAGTCGGTTCCTGGCAAACACAAGCGCAGCGTTTGGTGAACAAGCACCCCTGGCTGGCAGAGTGGCGTACGCTGTAAACAGAAA
GGATTCCTGTTGATGCCACGGATGCATGGGTGCTCACAGCAACTGAAATCGAAATGAAGTTTATTTTTCTTTCGCTTCCAGGTTTTATCTTCTACACACA
GCGGAAGACGACAAACGGCACATGCACTGTCCGAATGTGATGCACTATTCGGACTGCCACTCGTTCGCTCCTTGTGGCCCTCTTCATTTTGCCAGAAAAT
CGCCTCCATCCTCGCCACGTCGCCTTGCTAACTCTCTGACAGCTTAGTCGATCTTAATGGAGCTGTAGATCTTGCGCGTAAACCAGAGGCAAGCGAAGTA
GCCGATAGTTCCcgtgaggaagaagaacgtgacCGAAATCAGGAACATGTAGCCGAAGTACAGAATGCCCGAGACAAACGCGGTGATGTTcagcttcgtg
aagaagtacagGAACGAGTAGAGGAACAGATACACGGCTGCAGAGCCCGAGGTGAGGAAcgaacgccaccaccagcggtAGTCCTCTGCGCAAAGCTGGA
AGTAGCACATCACAACCGTCACCTCCGCGCACGTGGCCACAAGGATTAGCAGCacgatgaacaagaagccgaaCACGTAGTAAATCTGGTGCAACCACAG
CGCCGACATGATGAAGAACAGCTCAATAAACACAGCGCCGAAGGGAAGAATGCCGCCGACCAGGATGCTGAAAGGCGACGACAGGTACCACACTTGTTCT
GGGATCTGACGCGCGATCTGGTTCGTGCGCACAGGCTGctcaatagcagcagccttAAAGCCAAAGTAGCTGCCCAGGAAAACGAGCGGCACCGAAATGC
CGAACCACAGGACGAGCAAGGCGAAAAGCGTTCCGAACGGGACAGCCTGCGATGATGACTTGCCCCACAGCACCAGGTTCAAGAGGAAGAACACAGCGAA
CAGCAGACCCGGGTACAGCACAGCCGTAAGAATagtgttcttcttccagtccTTGCCGTTGAACATCTTGTACGTGCGCGATGAGTGGTAGCCGGCAAAG
CTTCCCATGAacacgaagagcagcagcagcgtcgtaaGCAGCGATCCACGGTTGGCAGGCGACAGCAGACCCAGCAGCGCGATGATCATCGTCGACGCAC
TCATAGAGCACACCTGCACGCCCGTGCCAACAACCACCGAGAACAGCATCGGCGAAAGCTGCGGCGGGCGGAAAACATCGCCGTGAACGAGCTTCCATCC
AGACTCCTCCTGCGCCTCTTCCGTGGTCTGCACCTCGTTGTAGCGAGCGATATCACGGTGAAGTGTGCGCAGCATGATCATAGCAATCATACCGGTCAGG
AACAGCACGATCATGAGTGAGTTAATAATGGAGAACCAGTGGATCTGGTCGttcgagctcttgctgctgataaTGCGATCCCAACGCTCCTCCCAGACGA
TGTCCGACTTGACGAACTGCACGTCGTACGTGTAGAGCACCGTGGTCTCGCCCTCCGGGTTCAGGTACTGGTAGTTGCCCTGCGACACCTCCTCAATGTT
GACGAACTTGCCGCATGTGTCCGAGTCGAGCTCCTGTCCAGCCATGGGCTCGTTCTCGTAGCTGTGCTTGATGGACGTGGGTACCACTTCGAAACCGACA
ACGCGCCACTTGGGGACGTCGCCGTCCTCCTGTGCGTACGGGTCCGGGTTGACCGAGACGATGATGCGCACGTGGTTGTACAGCAGATacttgccgtcct
cgtccacctcgccCACTGGGAAGCCGCGCTTGAACGCCCCCGCCTGCTGCGAGTCCGTCGGGTCGCGGTAGAGCACGGGCAGGTTGTCCACCACCCACTG
CACGTAGTACTCGTCCTTGATCATGTCGATGAAGGCCTGCGACTGCTTGGACGTGTACTTCATGGGCTTGCACAGCACCTGGCAGATggcgtccttctcc
atttGCATGTTGTAGAGCGAGTCCATGATGGCGTCGCCGGCCATGATCTCGCCCAggttctcctgctgctcgttggtGGCTGTGGGCTTGCAGTACGGCA
GGTAGTAGTACTCGTACGgcaccagcgtcttggtgGACGTGATCTTGTTCACGTTGAGGCGCACGGCGTCGCCCGCGGCCCACGACTCGGGCGCCACGCC
AGGCACGTAGAAGGCTGCGCTGGCCTGTTGCACCGCCAGGAgcacggccagcgccacgctCTTCATCCACATCGTTGGTAAATAGGCTGGGTTAGGAAGG
AGGGGGAGAGGAAGTTAGCTGCCGCTGGATGCACGCACGACGTCTGGCTTCTGCACGGTTTCAGGGAGTGTTTTGAGCTGGCCACGAAGCCGTCGCGAGG
ATGAATACCTGTGCAAATCGATGTGGTCATTACCTGTGTGAATCGATATCCTGTATTGACCAATCAAATCGAGCCACGACCGTGGTGTGTAGTACATCAA
CAAGCAAGATTTTGGAAGTGTGTACGATACACAACATACCAAAAGTAACGCTAAGCACGGCAGCGTCGTTGTTACTTTTCGCGAAGAAGACCGTGTTGAA
GCCCTCGTACAGTATAGCTCTCGTGCCGCCAGCGCACCGATCAGATAGATCTATCTACCTGCCAGAGAAGACAAAGGGCTCTTTAGccactcgtccagct
cccAGTTAGCGCTTGCCGCTTCCCCGAGATCGCCACTCGACGCGCGTGGTCTATTATTGTCCGCCGCTTCGTAGAACAACCCCCATATTCGAACAACCAG
AGCCAACCGTCGAGCGACTGACACGCGATGGAGgtggccgtcgtctccgaAGAAGTGGTGTCCGAGGCGCTGCACCAACTGTGCAGTCCGCTGACCTCCC
CTCGCGAGCGGCGACGCGCTGACTCCctactgcagcagttccagcgctCGCCCGAAGCCGCGCAAACCGCTTTGACCGTGTTAAAAGCGCCAATTGTCGA
CACTGGCAATGCTGACCATAATCGACTGCTGCGGACCAAGCGCGCGTTCGCTGCGTCGACGATCTACTTCTCAGTGGCCTCGTACATCCGCAAGTACAAG
ATGGACGACCCAGCCATCTGGACGCCCCAGGAACGCGCCCAACACGAACTTTTAGTGAAGGACTTTGGACTCATGGCCCAAGATGTGTGGAATGTGCTGA
CGGGGCCCAATGGCACACAGGAGGAACTAACCGTGCAGACCCACTTGGCTCTTACGATTGCAGTCATTTTGCTACGTTTCCACGAACCCCAGGGCGACAC
CACTATGGTTGGTGCAGTGGAGTGGCTCGTACAGAACCAGCAACATCCAGTTAGTGACGTGGTAACGGCTGTATTGACCAAttttgctgtgctgcttACG
CTGAAGGTGATCCCAGAGGAGGTGGACAATAAACGCGTCAAATTCGCCAAGGTCAAGCGTGTCCAGTGCGAGGATATGGTGCAGCAGTGCGCGGCGCATG
TGGTTGGAAATGTTTTGCCGTCGATTGCTACTGCTATTGATGCCGGTGAGGAGCAAACGCAGCTGCGAGGTCTACTTCTGCAAGCTTTTGCGAGCTGGGT
GGAACATGGCACAGTGCCGCCAGCAGTTATCATCGAGAGTGGGTTGTTGGACAGAGCCTTTCGCGAAACGTTGGCACCAGCTGATTCGGGGTACGCGTTG
CAGCTTGTACGTGAAGTGGTGCGAGCCTGCCGTCATGACGAGCATGTGCAGCTGATGGAGCTTGTGATGCACAATTTCGTGGCGCTAGGAAAACACATCC
AAGAGCGCATCGCAGCATCCGAGAAAAGCGTGGATTTTTGCCTTGCCGACTGTGCTAGGGCGATATCTGAATGCGGGCAAGCCTTCATCGTGTACTTTGT
AGACTATACGCTGGATATGCGGCCTGGATCCTTGGTGTATGAATTCCTGGATACAATCCTGTTCTTCACATCGCTGAACAACCTCGACATCTCGAACGAA
ACGATGGAGTTTTGGATTGACTTCCGCACTTACGTATCCGGCAAGCACGAGGATCGCATGTACGTATTTGAAACGTTCATATCTCGATTGTTAATCATTT
TGATTGAACGGACCCAGTATCCCGACGGGTTTGAGGCCTTCCCGGAGGCTTCCAAGGAGCGTTTCTTCGTCTACCGAAGCGAAGTTCGCGGTGTATTCCG
TGCGCTCGCTACGGTTACAATGACTAGCGAGGACAAGTTCATTGTAGATGCTATTCATGCGATCTTCCAACAGTACGAAGCTACCGATTCAGGGGCTCCT
TTACAGCCGAACGTAAGTGTATTGCGCGACGTTGTGCTGACAAGTTTGCATAACTAACTACCTCGTGATTTATGTGCTCGTGTTGTGTCCAGTGGTGGCA
ACGCACAGAAGTATATGTACACGCGCTTAGCGCGTTATCAAAATCGATTCGCGAGGAAGACACATTTCTCGTtccgaagctgttcgagtATTTGTCACGA
AAGGAGCCCTCTCACCGTGCACTCTTGCGCACGGTAACCATCTTCCTTGGTGTTGCCGGTCATTGGTTTGCAAAACACCCCGAGTACTTGTCGACCTACG
CGTTCAAAATTATTTCCAATGGCTTTGAGCTACCCCAGAATGATCCTGGATTCCCGTTCAGTCAGCACGGCTTAGCAGATCATGTTGGTGCTGTGGCACT
CCGCAAGTTGACGCTTCGCTGTGGCTCCTATTTCTTTAACCCTCTATGGATGGATGCACTGGTGAACCTGTACCGCTCGAACCGAGCGGCGGTAGGTGGG
CCTCTGGGGCAGCGGTTGATGGGAAATAGCTCAAAACTGATCGTGGACTCTATCTGCCATGTCCTCACCACAGTATCGTACACGGATGCTCTTCCTGTTG
TAGAAGAACTCGGCTCTATCATGTTTGCAGACCTTGCAGCACGTTACAGCCAACTTcatgcagacgatgaaggcTCAGTAGAGTTCCTATGCGAGATGTT
CAAGCATCTTCTCGTGTTAGCCACGAGGATTCCTTTGCAGATGGACCAAGAAATCCCACATCCAGTGCTCTGTGTGTTGCAAAAGCAGTGGGAGGTGTTG
GCGACAATTTTGAGCGTATATGGCTGCTGTGAAGAAGTAGCTGGTCAATTCTGCGCGCTTTTGGTAGGGGTCTTTGAATCTTTGCGATCTCAAGCGCTGG
AATTGGCATCCGCAATTACGCCATCAGTGCTGGAACAGTTTTCGCGGAGTCATGACGGAAGTTATCTGAACGTGATCAAAAGCATTATTGGTGtcgctgg
tgacgacgaggcTACAGCAATTAGCTTGACGCGTATGATGGTGATCGTCAGCGAGAGTTCAATGAGCAAGATCGCGGCAGACGGCAGTGTTGATGAGCAC
CCGGGTCTTACTATTGCGCTGTTTTCTTTGGTGGCTACTTGCGGCACCCACCATCCGTCCATTTTAGTCCAGTCGAACCAGTTGGAAGGTGTGTTGGCGC
TTGCACTGCACGCGTTTAAGTCGCAGAATCCtgaagtcgaagctgctACTCTCGACTTCTTGCTTGAATTGGGCTCTTTGTACGGTCAGATCCTCCGCAC
CCCGGAAAGCTTACTTCAGGGACCTGAGTTCGCAGGAAaactgctgcttcaccaacAAATCCAGATACTATTCTTTGAAAAGGACGTCCAGTATCACGTG
CTCTTCGCCCTCTTTAATGCCGCAGCGGGGGGCATGTCGCCAAACTTAATGGAGAAGATTGCAGAAGTTGTTCGATCTTGCTGGGTCTACTTCGGACGAC
TGCGGAGTGAAGAGCTCATTCAGCGACTGTTGTCCGACAGCAATTTCTTAGGCTCGCAGGTTAGCGAGCGCGCTCGAACCGAATTCCTCAACTACATTTC
CACACCGACTTGTGTGGAAAACCCGCGCAAGTTTAAGCGCGTCCTGAACGCGTTTTGTGACCACTTCAAACGCAGCCTTAATGGGATGAACGGAGAAGCA
ATGCCTTCGTGATAAGCTGTGCTAGCGAAAATGCACCGGGATCATACGAAAATGAGCAATTGAAATCGCAAGCCGAGCGGCAACGAGTACTTTTAAGGGA
TACGATGCCAAGAAAAACGCCTTGCTTGCCAAACTGCTCGTTTCTACAGAAACGGGTTGCCAACATCCTTCCAGGACGTCTTGCTATTCTCCGTAGTGGC
AGTGACCAAATGTCCACtcggaggacgagcagcgtAAGGAGCATTCGACCACTCCAAAATCTTCTCCGCAATCTCCTCTGCCTGCATTTCAACGTAACAT
GTGAGGTCATTTGTGTGACCAACAAACAGTGAAGCTATCGTAACCGCATCGCCGTACCTTCGTCCAGGTAGAAAAGTCCGCGTCGGTCATGAACTTGCGG
TTCATCGGCGTGTCGATCGTCGAAGGCAGCACGCCGAGCACCGACGAATCCTCAGGTAGCTCAGTCCTTAAGAAAAAGCAACCATTAGCTCACAACCAAC
TGTTGCGATCATGACGAACCAAAAGGCCTTACACGACACTGGCGATCAAATGGTGCGTCGCCGCCTTGCTAGCTCCATACGACACCATTTCAGCAGTGGA
CTTGAGCGCAGCAGTTGCACCCGTCAGCACGAGCAGCCCACCAGGCATCAATAAGTGACTCGCCAAGTACGTCGCTACAAAACATAACCCAAATAACTGC
ATTAGCAACTCCGTAGTATTGCGTCTTGCCCCACTCTCACTCACCCAGGAAAGCCGACTCGAGGTTCTTGGCGTGCATGTCGCCCAGATTGACCAGCGAC
TCGGCGTCACGGATGCTGCCGCCAGCCCAGCCTCCAGCAGTGCACACGACCGTGTTCACCTTGCCGTATCTATCCACAGCACCACAACAGGTCAAGTGTT
GATACAATACCCAATAGGAATGCATAGGAACCCGACCTGCTGGAgatctcctgcagcgtctgctcTGCCTGCTTGAGCGAGTCGCTCCTGGGCAGAATCA
CGTTGTTCTCGGCCTCCTCATTCGCCGAAAACCCCACCGAAGTGACGCCCCATGACGCACGCGCAAAGCGAGAGACCACGCCGCGACCCAGGGCGCCGGC
ACCTccaacgacgagcagcttcttggacatCGTGGGCGGGCAGATCGTTCAATGACGGGGATCAGCTGGTTGAA