Description :
From Genome Similarity Track
Location :
Scaffold_211:9233- 14961
Transcript NameFunction/comments
Hyaar_Emoy2812648metalloprotease family M01, putative
Hyaar_Emoy2812646membrane alanine aminopeptidase
Hyaar_Emoy2812647metalloprotease family M01, putative
Hyaar_Emoy2812649hypothetical protein

Sequence
5728 bases(100 bases per row)
GACCCTCGTCAGTGCCAAGTGAGAAATCGCGGATCTGCGATAAACCACGTGAAAGCGTCCGTCCGTGGCTGGACTGAGCTGGGTTAAAGCTAGAGCTTGC
CACGAGCTTCAAAATCTGCTCGCCCACGTCCTTTGCATCCAAGCTGCTCATAATGCTGATGTACTTCGTCAGCATATCTGGTGTCTTACGCCAGTCGTCA
AAAATCTCTTCCTGCACCTTCGCGCGCTGAGCGAAGCATTCGTCTTCAAGGATGAGGCGAAACCCGGTGGCCTGATCCGTCACAAAGGACGATTTCTTAA
GCAGATCAAGCGCTAGCTCGGATGGTGCCACCGTTGGCGCTACCGTCGGTGTCGTGCTGAGCACAGAAGGCTTCCCCCCAGCGACAATGAGCAGCAGCAG
GTGGCGCTTAAGAGCACGCTCCTGAAACTGCTCTACATGCGGGCCTGGACGAGCTGCTCCGCACAGCTTGTTGTATGCCGCCTCGATTTTTGACGAATAC
TTGGCCCACACTGCTTGCAGCAAGGCTGTGGTCGCCTCCTTAATGGCAGCATAATGGTGACTCAGGTCGTCACGACTCGGGATGGTCTTTGATTCAACCA
ACGTCAACGCACGTGCAGAAGGGGTGAGCTCATCTGAGAACAGGATCGAACCGTGCAGCTTCACAAATTCGGACGAAATTTCTACCGTCTTGTTTTGCTT
CAACAGTCCTTCAATCACCTTCGCCTTCTCGGCATCTGCCACGCTGCGGTAAGCCTGATACTTGTTTACAGCATCCGGATCGGACAGCGCTTGCTTTGTG
AGCCGCGCTACGGACGGATTCGTCTGCTTTGATTTGCCAAAGAAAGACCACCCACGGGCAAAAGACAGGAAGTCCGGCTCGTCCGTCACATCCGGGATAA
CAAGTTTAGTGTCTTGCGTGTTCATGAGAAACACGCCTTCTTTCATCGACATCCCATCTTTGACGAGTGACCAGTCGATTGGAATTTCCCAAGGACCATT
ATTCTCAGCAGGCTTGTCTTCAAAACCTGTCTGCGAGATCTCTACGACATATTCGCTGGAATCGGCCTTGTACTCCGTTGAGTACGTAACTTCAGGGTGA
CCCGGACGGTTCAGCCATGTCTTGGCCAGATTTTGCAAGTCAAGTCCCGAGCATTCTTCCATGCACTTGATCCAGTCCATACTCGTGGCATTGCCAAACG
CGTATTTAGTGTGATACATGTCAAGTGCTTTATGGAAAGCATCCTGGCCCAAAAGAAGCTCCACCATGCGGACGAACTCAGGAGCCTTTGAGTAAGTTAC
AACAGATACGAGTTCCTGAGTCTGATTGAAACCCTGCGGTTCGACAGACAGAGATGTCGCCGACTTGTCTTGAGCAAGAGGTCCAATAGCCGGAGTGAAC
ATGTACAGCACTTCACTCAGGCGACTGTAGTCGTTGCCAAAAATAGCCGCTGCACGCTTGCGTTCCATGTGCACTGTGACAGCCTCATTCAGCCAAATCT
CGAAAGGTGACTGACCCGTAACCTGGCTGCCGTTGATGTTGTGGTAGTACTCGTGGACTTTCACATGTTCCATGTACTCATACGACTTGTCGTCCATGCG
GCAACTCGGGCACAGACACGAGCTTACAATGGTGGTGTTACCGACATTCTCCATACCGCCGTAGTACGAATTCTCCATAGCGATCTCGCGGTACACAGCA
CCAGAGTACTTGTAGCCAGTCTTCTTCCACACCTTGAGCAGCTCCTTCAATTCCGCGCGAACCGCAGCCAGACGTGCAGTGTCCGCGTCACTCAGTGGCC
TTTTAACATCCTCCTCGTGGGGCCCAAGGCACAGTTCGCCTTCTTTAGCCTTGATGGCTTCACGCTCTTCTAGCAGGTCGTACATACGTTTGCGCTCGTC
ATGGTGTTCGCAAGCTTCTGGGCCAAGACTCACCATCACCCACAGCACAGAGTCGTGCAGCATCTTGACAGCTGCTTTGGCGTCAGCTGCTTCAAAGTAG
CCCGGGAACGCCAAGATCTCCAACAACGTCGTGTCTCCGTCCGGGAACTCAAGTGTCCGTCGGAATGTCTCGTAAGTACCTACACCTAGGAAGAACAAGT
ACGGTGCCATGTTTACCTTGTGATTATAGTACTTGAGCACATGGCGCGACAGATCATCGACGTGCAGCACTTCTGCTGCCGGGTGGAACACAGGCACCCC
CGTTTCCGTGTGGAATCCAGGTGCCAAGTCTCCGTTCGTAATGACGTTCGTATAGCGCTTATTTGCGACAATAGTTGTCGTATAATAAGCTTTGGCATCC
ATCGTGTCAATACACGGCACAATGCGCTGGAATCCATGCTGCTGGCACTGCGTGATGATCGTCTTGGGGGCACCCTCCGGAGTATAGTCATAGTATAACC
CTTCCAGTATATTCTCAGTTGGAGTGGCCACTGAAACAGTGCGGATCACAATCTCGTCTCCAGGCTCCACAGCTTTGGCAAATTTGAGGACGAGAAAATG
GTCCTCCTTGTCCACTTCGTACTCCATTTCACGGAGCTCTGCAAAGCTCTGCACGTGAGCGACAAAGTTCTTTGTACCGCCCAATGGCGCAAACGTCTCG
ATTTGCTCCACGGACAAAATCTCCAGGTCCTTTGAGTGCAGTTTCAGCTGCGAGAGCGACTGCGCTCCGTCATGCTTGAGCGTCGTCTGCAGCGTCACCT
TCACCTTGGCTTCTGTGATGTCAAACACCATGTCAAAGTGCAGCGGCTTCGTCATGAGAGGCTGGAAGTCCTCGCGCGTGAAGCGGTACTGCTTGGCGGT
CATCATGTTCTTCGTACTTGGCGGTAGATCTCGTAATGGTACACGAATCCATATTTGGTGTCAAAGTTGATTGTCAGAGTTTTTGATCGCTTTACACGGG
GAAGTTGAGGTTGAGTTTCCCTCTTCTGTTCGCCAACGATTGGTAGAAACGATCTCGATCAGCGGACACTGATCGCTAAATAACTCTCTTTATTTATGGA
GCGTCTCATGTGCGCTCAATTCGGTCGATTTGCTGTTTCTTCAGTCTTTTTCATCGAAAAACGCTGTCTTGACAGTTACGATGGACCCAGCTAAAGACTG
CATTTCGTCTGCGTCTTTTTATCACGCACGAGGAAGGAAGCGCTTTTACATGATGCATCTTTGTTTCCGTAAAGATGAATCCACGCTTGAAGTCGACTGC
CTCATTGAAGCTGCACATGCGTCCCAAGATGATAGCAGAATGCATCGTCGATCATGAAGCTGGGGAAACTCAAAATACACCAAGGCGCAGTGTTTAAAAC
ACCGAGGATCTTTTTAGGCTATCCATCTATCTTATTTTTTCTATGCCGAAAAATGGTACAAAGACAACCTCGACTTTGGTCTTGGATACTGATGGAGATT
TATGCCGCGCGGCTTCCTCAGACCACCCGGAGGTGTCCTGCGGGTTCAGTGACGCTGCTCCTCGTTAGGAGCCCACACCCCTCATTACACTATGGGTTTG
GATACTGATGGAGCAACACCACATTCGTCCATAAATACTCAGTTGATATGCGTGCTCTCTGTTGTCCGAAAGTTTGCGATGTACATTAACCGCTGGAATA
CTCGGCTCCAAGCGTGGACAAGAAAGTGATGCTTGTGACGCACGATCATCCCTTAGACGATACGCCTGCAACAATGAGGCTCCATCCCGCTCCCACAAAA
ATCAGTCGAGTTGCGTATCGCTACGTATCCAGGCCCATTTGTAAGAGCTCGAATCAGATTGAGACGTCTGCGTCCGTGTGGGTTGCAGGCCGGAGTGCGG
ACATGCAAGCCGTGGATAAAGTTCTGCCGTGAGAATCAGCCAGTGCACGCTGTGTCTGACGTCCTCAGCCGAGCTCACGACTATAATGTGTCCGGAACAT
GCATGATATGGGATCCGTGGGTTTCCCATGAATTTTCGTTGGATTGATTTCTCTACATTGTGGTCATACATTCGATAACTCGCGGTGTTCAGATGACACA
ATCGTGACAAGGCTGATGTGTAAATAAATGGTAGGCGAGTTGAATATTGCTTGCGGATACTTTCAGCGGCTCACTTGCATAAAAGTGATTGTCAAGTGTA
TTCTATTGTGTGGGGTCGTGCTCTGGTGTGGCCACGCTTGCTTTTGTGGTCAAGTGGTCGAGAGAAATCCTGACCAATCGCATCTTTTACACCATGGGTA
CATTGGGACCGGTCACGCCGGCCTTGTGAGTGACCGCCAGAGATCTCTAACGGTACGGTAGAAAGTTGACCAGTCATCAGTCGCGGTCACAGACGGTGAC
CAGCGGTCATGATCACGGTTGACGACCAGTGATCATGGTCACTGTTGACGACCAGCGGTCATGGTCACTGTGGACGACAAGCGGTCATGTTGGAATTTGA
GGTGGGTCACTTTCAAGCGCGGGGAATGGATGGCGGGGGGCAAACGACGTAACAGAAACTGAGATACAGATAGGGATAAGCGTAGTTCTTGCTCTTAATA
GGCTAATAACGAACAGTATTGATTTTCCTACAAAAGACACCGTCAGCATCCCTCCGAGATGGAATAATTGTGGCCACCCTACGTTCAAGGTTTACGCTCA
CGTGTTGGTTCAAGGTTTGTCCCTAGATTGCTTGGCTAGGGACAAAGATACGCATTTAAGTTAGCCCGCGATCGGACGCGGCAAGCATATACAGGCAAGG
TCTTCAGACGGCTCAAGTGATCAGAAGAAGAAGGGGATCAAGTGGTCTGAAGAACAAGGGGATCAAGTATCCACATTTGGGAAAGGCGACCTCAAGGAAG
GTCAGGGCGACTCTGGGAGAGCGCCACAAGTAACCGTTGGTCGTGTGAAGAATTCCCACGCGACCACACCCCACCTATCCCCAACTCGGTCAGGACAGAT
ATCGACCTCAAGCCACCTAGAGAGTGCAACCTGCCTGCCGACGAGTACACGAGGTGAGAAGGAACAAGACAAGACACACGGTCCGGAATACCCCCTCCGT
TTGTCGGTCTTCCGGGCACAAGGGGAGAGTTGGGATCACTTTGCAAAATGAGCGAATACCACTCCACCACACTTTTGCGAGACAGTGAATATACTTCGAC
GCTTATAATTGCGATGAAAGCACAGAGCCCGAGTCTCCGAATGATATTCTTCCAGCGGTTTTCGAGTTTATGTACGAAGAAACCATGCTTCATCATATTT
TTACGCTTGCGGTGGTAATATGGACTTGTTGAACTACATGCGCGTGAATCTAGGTACTTTTAGTGGAGACACCGCTTGCACGCGCCCAAGACATTGAGAT
TAAGACCGCAAAAGTATGAATGATGTATATATGAAACATCAAAAAGCAGTACAGAACCCCGATAATGGAGCCAGCAATTTAGTGGGATTTTGAGATCGTC
AGTGTCTTCCGTAATGTCAACATACGTCGTATCGTCCGACTGTTATCGTTAAATGTTGGTGAGAAGTTGTGTAGGGGTAGCCGGTACCTCGTATTACAGG
CCATTATACAAGATAAGCGCAGCATCAACGGATACTTAATACGGGGTGAAGCATGGATGGAGTAGGCCGTTCGAAAAGAATGTAGCGCGCCTATAGGACA
TACAAAATAACGGTTCGTGAAAGTAGAAGTTGATGATAACCTGATGGAGCTGGTAGCCTAATTTTCTTATCAATTGGAAAGGGTCGTTTTGTATATTCGT
GTTAGTGTTTATGTTAAAGATGAGCTAA