Description :
From Genome Similarity Track
Location :
Scaffold_66:9233- 12749
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_66-abinit-gene-0.75Phosphomevalonate kinase
Pytap_DAOMBR444snap_masked-pag1_scaffold_66-abinit-gene-0.69Protein phosphatase 2c

Sequence
3516 bases(100 bases per row)
CGTGCGGGTGTCGGCGCCCGGGAAGGTGCTGCTCACGGGCGGGTATCTGGTGCTCGAAGAGCGCTTCTCGGGGCTGGTGTTGGCGACCAGTGCGCGCTTC
CACACCACCATCAGCCGCCGACCAACGGGgCAGCAGTTGGgCGAGACGGAACTGTtGCGTGTCCACGTCGAAAGTCCGCAGTTTGATCAACATGTCATTG
CCAGCGTTGTCGAAAGGTCCCAGGGCCGAGTTGAGTTGTGTGTGGAGTAAGTGAACGCCgTAGTGATAGAGAGAGCGCTAGATCAAGCACCCTAAACGGA
CTCTGTGGTGCTCTAGTGAGTCATCGGACAGGAACTCATACGTTGAGGAAACGCTGCTGTGCGCCTTGAACGGTGTGCTGGGACTCGATGATCCTACCGT
CAGACGCAGCTGGGGGCAAATCAAAGCGGCAGGACAAGAAGTGCACaTGCTTCTTCAAGCAGACAACGCcTTCTACTCTCAGGCgACAAGGGTgCGGGgA
GAACCAACCAGCAGCCCAATCTGagAGaCTCACGTAtATTTGACTAaTgTACAGCTCCAGCAGGCCAAcAAGAGTGTATGCAGACAACATCTTGAAGAGT
TGCCAGCATTCCTCCCACCGGTCCTCGAAGGTATGTTGATCAATCCGTGGCCTAGGgCTTCAAAGGCTGACTTGGTCGTGAACTAGTCAAaGGAAaTGGC
GAAAaGACTATCGCCAAGACAGGTCTCGGTAGTTCCGCGGCGCTTGTGACATCTCTTGTCGGCTCTATCGTGcGGTTCTTCATcTttGACAGCGTGTCTC
TCGACATCATCCACAACCTTGCACAGCTGAGCCACTGCTTCGTTCAGCGTAAGATTGGTAGTGGCTTCGACGTCTCGGCGGCGTGTTATGGCTCCCAGCG
CTACTCTCGCTTTCCCGCAACGCTTCTGGATGCGTTCACAGCACTCGACAATCTCCAGCCAGCCTTGATTGCTGCCtGTGTCCAAAACCAGAGCAATTGG
GCTCGAGAGCAAAGAGTGGTGCGTGCGTGACGATCGACGTTGCGTAAGAGGACTTCTTCATCATTCAGGCTACCACGTAGAAACCATTCGCGATGCCCTC
GAACTTCCACCTGCTTATGGGCGATGTCTCGGCGGGCAGTGCTACCGTGTCTATGGTCCGCCAAGTGctGCAGTGGCAGAAGAAGGAACCAGCACAGGCA
GAGAGGGTCATTcTCGAGCTATCCACCGGCAACGACGCCGTGGAGCGCAAGTTCCAAGAGCTACGCAGTCTGAGCGAGCACGACAGCGTTTCTTTTGAGA
GAACATGCCGAGAGATGGCTCACACGTCTGCTGACAATGTACGTTCTATCTTCtGCCTCTCACTTCTGGAAAAAGAaTATTCTAACaTCGtCcTTaGTGG
AAGCACGTGGACGCAACGATTGGGCGTCACTTGGAAGAGCTGCGTGCTGCGTATGCCCGAGTCCGACGCGCTTTtCGgtACGGATGGATAAaGGCTTGGG
CAAGCAGCGTATCGAGACTGAGTCGTTTTCATTTtCAGTGAAaTGGGCGAGTTGGCCGATGTGCCCATCGAGCCTGCCGTGCAAaCGTCCCTTATTGAcG
CGACcTTACAGGTGCCTGGTGTGCTCATTGCAGGTGTCCCAGGCGGTACGATCCTCCGCTATTCTTtCGGTTGAGTCGGTGCTCATTGCATGATGGTGTT
GGTAGCTGGTGGGTACGATGCGCTCTTCGTCATCACGCTGGACGCGtCCGTAGCGGACACCGTGGAGCAGCTATGGCTCCAGTGGACACGCGCGAACCCG
GCCGCAGTGTACGTTCCGTCACGTCTCACCTGCATGCTCTCCTGTCCCTCTTCCCGTCGCTGATGTCGTGTGGTCTGTAGCATCTGCCCATTGCTGTGTG
ATGTCGCGCCATcTCATGGCGACACCTTGCAAGTGGAAACGATTTAAAGGTTGAAGTCGCGACgTTTCATCTGATTGGTTGTAAATACATTTTAGAGGTA
TTTTGACCAATGAAATCGAATCTGCTGTCAATGGCATGCGTCTTGTAGGCAGAAGCGACCAGAAATGGAGGTGACTCGGAAGCGCTGGCGTGAAAGCGCC
GCTGGTGGCGACGAGAGCGGCAACGAGGCCGACGAGCAAGAGAaGCATGAAGAAGATGTTGCGCAAGGCGAGGCAGATGGGCACGCACGTGGTGATGGTG
TCGAAGCCgAGGCTCGGcGgCCCGaCAAACGACAGGAGACGgCGGTGtCCAGCTTCACAGTCGATGGACtGGTGCAtGGCTGTGacTCGTTCCGTGGGAG
GAAGATCTCGAACGAAGATCGCCATGTCGAATtCATGGACGCATTTCCCGGGCCGgTGTTTGGTGTGTTCGATGGCCACGGCGGCGTCAAGACTGTCGAG
TATCTCaTGCGTCACCTGGTGAAGGCAGCAGCCAGCGCCGTCAAGCACCACGTTGGCACGAATCGCATGGCCGAGGCTGTGGCGTTGCGCGGGgAGTCCA
GGGAaGCGGTAGCGCGGCAACGAGCTCTCGAGAAGCAGCGAGCGCTGTGTGAGGACcAGGTCCAGCAACCCGAGAGCGTGGTCGAGCAATCGGCGGTTGG
AGAGACCAGAGATGAACTCGTGTCCGTACAAGCTCAGCTCCGTCAGACAATAGAGGAAATCGACGAGGCGATTGTGACGATCAAAATGGAAGAGCGGCGT
CGCATCCAATCGCTCAGTGAACTAGTGGGCGAATGTGGCGTTCCTTTTCGCAAGGCGATTACGAGTGCTTTCCAGCAAACTGACACCCAGATTTTGCACc
aGAACGCCgATGACGGTTCagCAGCAGTGCTCGTGTGGTTCGTAGCGGATGTGAACCCGACGCTACCTCCTGTATCTCTGTATGCGATCAACCTGGGAGA
TTCGCGAGCTGTGGTTTGTCGACGGGGCATCGCAGTGGACCTAACTCGTGATCATAAACCCAACCTTCCCGATGAGAAGCGTCGCATCACCCAAGCAGGA
GGATTCGTCGGTGAATTCAATGGTGTCCCTCGTGTCTATTCTGCCTCTGGTGCTGGTCTCTCTGTATACCCTCGAGCTGCGACGTACCTTGCAGTGTCTC
GAGCCTTTGGAGATCCGTCTCTGAAGTCACcTTCCGTTCTCGTCTCGTGCGAGCCAGAGATCAAAGCATATACTATCACAGGCGACGATTTGCTAGTCAT
CCTAGCGACTGACGGAATTTGGGATGTTATGAGCAGTCAGGAAGCTGTGGATATCGCTATCGATCACTTTGGCTtTCCCcaGAAGTCAGCAGAAGCTATC
GTAAACGCAGCATATCGGCGCGGAAGTGCCGACAATCTCACCGCGACAGTGATCCATTTCtCGTGGCAGtCGGAGTTGGCAGCCGAGGTGCACCGTGCGC
GTTCATTGGCTCAAGAGGGCCAAGGACAAGTGCATGGTGGCGACAACATAGCAGACGCTAACAGTGTCCAGTCAAGTGACGATGGTGATGATGAAGTCGA
CATGTTCAACTTATGA