Description :
From Genome Similarity Track
Location :
Scaffold_431:9233- 12290
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_431-fgenesh-gene-0.1MGC89050 protein isoform 2
Pytar_ATCC12531maker-par_contig_431-fgenesh-gene-0.5Ubiquitin carrier protein

Sequence
3057 bases(100 bases per row)
ACGTACCGCTGCGGAAATGCTTCTGCGCGAGCCGAAGGTTCGCCGGTGGCAGCGAGCTGAACCACAGAATTGCGGCGTCCTCTTCTTTCGCGTTGGACGA
AGGCGCGGTCTTTGCAGCTCCAACGAGCTCTTCATTATTCCTTGGGTTCTCCTTACGTCGATTCGTCATGGTCGAAGACGGCAAGCTATCCCCATGGCTT
GAATCGCCTGTGGATCCGCTGAGGGCCATTAGCTCGGTAGCTTTGATTGTCGAGAGCGTGCCGTCGCTCTCCGCCACCACTCGCAACGCCGACTCGAACT
CGTCCTTGTAAGAGAGCTCACTCACAGCATGCGCAGGTAGATTCATCTTGGCCATGGTGAGCTTGAGGAATCCCTGCAGCGATCCATCCAGCCGTCATAT
CTCCTGAACCAAAATGGCAGGTCTGTGTGAACCACCTGAAGACCTCTACGCACCTGTTTCAGTAGCTCAATCGCGTGCTGCTGGTCTGCGAGATACTCAT
CGTACTGCTCGACCACTTGGACGAACCGCTCGTCGTCCTCGTCGTTCGCGCATGCCTGCGGTCGCGGTGATGCTGGCGCCCCCATGTTGAACTGGGTTGC
GAGGATAGCTTTAGAAACGCATCCACAAAAGTGAGCCAATCTGCCAGCCTAATAGAAACGTTAGATACGACAGATAACGGCGCGACCGTTTGGCGCCCTC
CATTTTCAAAGAGCTACAGCAAGAAAATGAAGAAGGCGGCGAAGGCGAGCAAGCAGATCTCGCAAGAGACGTTCGACGAAGTCGTGAAAGAGAATCTCGA
GGACTTTGACATGTCGCTGGAGGACGCCACGCTGGACGCGGTCGCGCAGTTTGAATCGCAGGGCGTGGATCTCTCCAACATCATCAAGCGAGTCGGCCGG
GACGATGCGAATGACGACGCCGCACGGTCGGCTGCCGAGGATCTGCGGCGACTGGAGAGCGTCATCGATGCACTGAAGACGGCGCCGGCCGATGCAGACT
CGCTCGTTGTTGAGAAACTGGATGCGCTTGCCGCGATGCTCGACCAAACGCCCGAAATGAAGGTCGTCGCTGGGCGACATGACGCTGTCGATACGGTCGT
CGCATTGGTCGGCTCACCCAACGACGCTATCGTTGAGAAGGCCAGTGCATTGCTGGCTCTGCTGTGTACGGACAACTCCGACCACCAGGATTTCGTTGGC
GCGGCGGGACTTGAGCAGCTCGCCCAGGCGTTGGCGACCGAGTGGGAGACTCGGTCCACGACTACGATCGCTCGACTGCTTCAAGCCGTTCGTGTCGTGT
GCAGTAAGCACGAATCCAACAAGAGCCACTTTGCCAAGGCCAAGGGCGTGGACACTGCGTGTCTCTATCTGGAACGAGCCGCTCAGGCAACGGACGACGT
CCTCTCCAAGGCCGTCGCGGCTGTGCTGCGAGTGGCCACAATCAACGACGACCCCAAGGCTACCTTCTCCCAGGCCCAAGACACGATCAAACTGCTCGTC
GCCAAAGACCTCATCGCCTACATCCTCGATGTGGTGCAGACCCATCGCGAGCAGTGCGATGTCCTGTCCGCGTGGCTCATTGTGCTCAAACAGCTCGCGA
TCACAGAGGAGCACTGCAAGAAGATCTACGATCTCGGTGGCCTCGACCTGCTCTTCCAGCTCATGATCCAGCACGAACGTAATCTCACGGTCGTCAAGCG
ATGCGTGACCGTGTTCCGCAACGTCGCCGCAGCGGATCCCATCAAGGAATACATCATCACGTCCGGAGGCGCCGAGCAAATCGTGGCGGCGATGCAGACC
CACCGCAGTGACGCGTCCATGCAGCAGCACGCGTGTGCGACACTCGCGGCGATCGCATTACGGTCTCCGGAAAACAGCACTCGCCTCGTCAATCTCGGTG
CCGCCCGCATGATCGCGATGGCAATGCGCACCCACAAGACCGACACGGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGACCAGTCTGGCGATCCGCA
ATATGGTGGCACGCGCACCCGAGTTGCGCGGTCGCTTTCTCGAAGAAGACGTCGAGGAACTACTGCGCTACGCGCAGCCGTACCGCGGCTGTGGCGACGA
GGCCTATGCGGCGCTCAGGGATCTCGGCTGCGACATCAAGCTCTCGTCATTCGGCACTGGCACGCAGCCGCTGGCGCAGTTCAACCCTGTCAATGTCGAG
TCCAACAAGTTGCTCGACGCTGTGGAAGAAGCCGCCGAGGCCCCCTTTGCGCAGCATGCATAGAAGTAGTAATACTACTATTACACTTGAAAGTATTAGA
ACTGACCATGCGTATGATAGTACTTGTTAGTGACCTTCCAGCAATCAAGGGGCAACGAAATCTGCAAGAGTGGAAACGTGGTGACTGGCATTGTGTAGAG
AAAGCGTGGACAAGTACATGTAGCGACGCTTGAGGGGGGTGATCCGAACGATCTAGGAGATGGACACCCAGCTCTGCTCGACGATCTCGCGCACGCGGCG
GTTGTACTCACGTCGGTTCTCCTGGAACAAGCGCGCGGCTTCGGAATTTGCGGGCGAGTTCGGGTTCGGATCACACAGCAGCGACTGGATCGAGGTCAGG
ATCGCCGAGATGTCGTAGATCGGCGACCACTGGTTCTGCAAGATGTCGAGACAGATCTGGCCGTCGTTGTAGACTGTTCAGTAGTACGCAAGAAACAGGT
GAGCACACCATATTCCAGGGATCTCTAGGTTTCAGAGTAGTCGTACTGTTGGGGTGGAACATTTTCGTGATGAACTTGACGGTCGGCGCCTTGTTCGGGT
AGTCCTCGCTGAACTCGAGAGTGAGGTTGAACGTGCCACCTTCCCACGGCGTGTCATCCGGACTATAGGCCAGCCACACGTATACAATCAGTTCTCCTTT
CCCACATAGCAGGAACTCCCAGAACAACGCACCCAAAGATCACTGCCTGCCACAGCATGATGTTGTTGTCCATGGGCGCGCCCGAGACGCCCGACGGCGG
ATCATTCTGGAGCTTGCGGAAGTCGCGCATGAGGCGGCGGCGTGCGGCGGTCGACAT