Description :
From Genome Similarity Track
Location :
Scaffold_154:92313- 93630
Transcript NameFunction/comments
g6692.t1hypothetical protein

Sequence
1317 bases(100 bases per row)
TTTCAACACTCCTCCACGCCGGCAGCGGCGACCTCCCTCTCGTCTCAATGGAGACCTACGATGTCCCGCAGGTTAGCCAGTCTCGGTGCCTCCAAGGCCT
TGGTGAGGACGTCTGCTGGCATCTTCTCGCTCTCTAGGTACTCGGCCTTGAGCACCCCGCGCTTCGCAAGCGCGCCCACGAACTTGATGCGCACATCAAT
GTGCTTCGCCTTGCTCGATGAGCTTTCACCGTCGAGCTGCTTGAGCGCCGCTTGATTGTCGACACGCAGCGACATCGGGCTGGCATGCGTGATGCCCAGC
TCTCCAAGCTACTCGCGCACGCCCAGCAACTCTGTATCCATAACCGAGGCCGCAGTGTACTCAGCCTCCATGGTGGAGAGGCTGACGCCGGTCTGCTTCT
TGCAGATCCACGACACGGGCATCCCGTCAACCGTGAGAAGGCCGCCGGTCACGGACTTCCTGTCCGTCTTGTCGGCAGCGAAGTCCGCGTCGCTGTACGC
GATGACCTCCAAAGCCCCATGGCCCTTCATGCTTATCCGCAGACTCTTGGTCCCTGCCAAGTAGCGCGCGATGCGCTTGCCGAGCTTCCGTCGGACATCG
TGGGGCTGTGGGTGCGTCGGGACGCTTTGTGCACCGCGTACGCGATGTCAGGGCCCGTGCAACGCGCCCTGACACATAAGGCTCCCCACGAGCGACTGGA
ACTTGCGTACTGTCACCACGCCATCTCCTCCAGTTGTGGGCAGAAGCTCAACTGACGCCTCGTCGATCTCGTTCCACTCGGCGCCGATCGGGGTGCGCAC
GCTGTGCACTGACCCCATCCCATGCTCGCGCAGCATCTCCTCGATGGCCAGCTCCTGATCTAAGTCGTAGCCCTCGTCCTCGGCGTATGACACCCTCATG
CCGAGAAACTTGCTGGCGGGGCCGAGGTCCTTGATGGAGAGCTCGGTCAGCTCGCCGAAGAACGCGTCGACGGCTTGCTGCTGCATTCCCGTGACCAGCA
GGTCGTCGACATACACGCCGACAGCCACCAGGACGCCTTCCCGGCGCCTGTGGTACACGCACATGTCCGTCAGACTCTGGGCGAAGCACAACTTGATGAG
AGCCTTGGTTCCAGAGGCGGGCTGCCTGCTTGAGGCCGTACAAAGCCTTCAGCAACTCCAGCACCAACTCGCAGTCGTTGGTCACGCCCAGTTGCTTACG
CACGTCTTCTGGAATCACCATTCCGCGCGGCAGGCGCAGGAAGATGTCCAGCTCCGCCTCCTTGTCGGCCTTGACGTACGCGTTGGGCACGTCGCCGTGC
TTCGCGGGGACTCGCCA