Description :
From Genome Similarity Track
Location :
Scaffold_53:92302- 95834
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16032callose synthase
Phypa_INRA-310PPTG_16033hypothetical protein

Sequence
3532 bases(100 bases per row)
CATTCGCGCTGCTGGAAAGAAGGATGATCTCATGCACGCTATGAGTGATAACACGCTCAACGCAGTACTGAGGAATATGTCAGAATCGGAGCTGAGCGCG
CTGCAAGACTCGTCCATTCGCCTTCAGGCCATCATGTCGGAGGAGGAGCGCAAGGTCGCCCAACGCAAACAACAACAGGAAGAGCAGAGACTCGCCGAGG
CTGGCATGAACTCGTCCCTATCGCGCACGCGTCGAGCCTTCTCCACGAGCGATTTCTCCGCTATTCCACTGAATGCTAGCCCCTACAATCTCCCCAACCA
GGATGGCACAGCTGCACCCAGCACTCGCACCACTAACGGTTCTGCTGCTCACGGACCTCAAGCTGGAGTATAGGAGTAGATACGCAAACTTTGTTAGATG
AATACGTTGGTAGAGCGAGGAGCCCATTGCGGCCAATTTGCATTTTGATAATGAACTACCTTCTGTTCAAACGTTTGGCAACACACAATTCAATTCCGGT
TGTAGTTAAGCATTTGTATTGATTGTTTGCCACCTTTGGTGATGAATACGCTACACGACACATACATCGTACTTCGCTGAAGTAATACATACAGAATCCT
GACGCTGTGAAGAGCTACATATGGTCACAAAGCTCAGTAGCGCCGGCAAAATCGCAATACCGTCACGCTGTCAGCCATGCCTTGATCACTGGTCAGACTG
TTTCCTGGATCTGGGCTTCTTGCCAAAGCCGAGAAATTTCATGTTGGCACTCAGCTTCTTCGTCAGTGAGCTCTTCTGGAAGGAGTCAGTGGTGTACAAC
ACAGCCGACTTGAAATTCTCGGCCACCTCAGATGAGCAGTCACATTCCTCCAATTTCTTCCCGATCTCTTCCAAGTTCTTTTCCGAGATAGAGCGAATGG
TTTCTAGATCCTCGACCAACTGTGACGAGGACACATTAGAGTAGATCTTGCGGCTGTCCGCAGCGAAGCACTCGTCAATATCTTGGCTTGGTGACATGGC
TAGATTAGCAAAAAGCTGCTGAATTGCTGGCGAATTCTTCTCAATGAAAGGATTAAGAACCCTACAAGTATTAATAAACACAGATTAGTAAGTGCAGAAA
TATCATACCAAACGATCCACTTACTTGAATTGAGGTTCTCGATCTCCAAACTTCACACCAGTTGCAGTCTTGAACAAGAGCTTCGTGACCAATACAAGTA
CTCGTCGGGTCTCGGGTGGTGGAAGTTGCTTCGTAAGGCCGTACAAATGTGGAGTAGTGATGGCCGGACATACAAAACGAAGGAACAGGAAACCTCCAAT
AACAGACTATCCACGGAAAAGCAAGCAAAAGTTAAAGCCAACGAACAAAGACATCATCTGGCGATGGCACGTACCCGAGTCAACGTCGATGCGTCCTCTG
CCTCAACTCCTTCTTTTGTGCCATCAAAACGGCTGATGACTTTCGAGTTTAAGTGCGAGCAAATGTGGAAATAAGACGATGGTATCTGTATGCATCGATA
AATAATCTAAGTTAGCCTCAGCCACCACACCATACTCTGATCGCATGAAGTACTTACACAGTGCGTATTTTTCATGATCGAGTCGATAATGTTTTGACAC
GTCCGCATCAGGTTAGCAGCGTTGGTGTCTACTTGATTCTCATCCTGCAGTGACTCCTCCTTGTGCGGGTTGAGCTCCATGTCAGCAATCTTCAACTTAA
ATATCTGACGGATAGGATCCGAGAGAGCCACGCGGATGAATTTTGACCCGATTGCCTTGCTGTATGTGGAAACTAATCGGCTCGCATAATCATCTGAGCG
GAAGAGCGTTGCGACGTTAATGACCGAAGCGACTTCAATCTCGATTGCCCAGCGAATAAGGTGACTCAGACGGTTGCGACTCCCAAACACCCGAAGGAAG
GGAGCAAGTAGCACCATTTTATCTTCTCGGCCTGCACTTTGTAGGATTGATGCCACAACTGACATCGTATCTTCCACCACCAGTGACGGGAGATCCTTTG
GTGCCCGTAGTGTCGGCATCTCAATATCTCCATTAAAAAAGTCGCGTGCTGTTCTAGCGTGGGAGAAGAGACTGCGTATCCTCGGGCTTGTATCGTTGGA
CGAATCCGCAGCAGGTGAGTCTGTTCGTAAAGCACGCTGCCCATGAGCTTCATCAAGATCATCCACTTCCTTTGATGGTTCAGCGTCAATTCCTTGGCGA
ATCTCGGCAATAATTTCATCGCTGATAACTAACTGGTCGGGCTGGCGGGATTGATCCGGCTGAGCGGACACAATGAAATCCTTCATGACTTGGTGGATCG
AATCCAGGAAGCCACTCGCCTCCAGAAACTGACTGTCCGACTGTAGATACACAAAGATTCTAAGTAAGCACTCAGCTGATGACTGAATCGTTCCGTAAAG
TCACGTCACTTACCGCCTCAAACTCGGATAGACGCTCAATTTCTCCTTCCTCATCTTCATCGTAGAAAAGATCATCCTGTGTGATGGAGAAAATACTCTC
ATTGCTTTCGTTCGAGTTGATCTGATTCAGACCAAAGTCCGTGACGTCTGCATAAGCAACACTCACGTTAGAGCCAAACAACTTCACCCTTTGTAGCTTC
TACCTGACCATACCGGAAAAGGAAGACTGCGATTCGAGGAGCGATGACGAACTGGAGGAGGTTTTCAAATGAATCTGGCACCAACTCAGAGCAGTTAGCA
TCGTCGAATCAGAATGCGGACGAATATCTGTGGTAAGCAGCTTACCTTTGACGTCTTGGGTTCTACTCGGAATGAAGACTGCAGATTGCGAGCAATCTCG
GCGAGTTCCATCGCTTGTTGCTGTAAAAAGTCATTTCCAGTGTTCGCACTCGAATCAAAGACGCCAGTACCGCTGTGTGATCCCTTGAAACTGGAGGAAA
CAGAGCCATCCTCACTGCTTTCACGAGTCGATGCTGAATCGGTGTCATCCTTGTGCAAGTTTCGAGCCATCTCCGCCAATTCTGCTGCTTGCTGTTGAAT
CGTGTCATTCTCAGCTCCATCACAGCACTTCGTCGATGTTGTGCTTGATGAAGATGAAGGAGACTCCGAACGCACAGAATGCTCGTTAGTATGTTCTGCC
ACCGGCATATTGTCTCGGTTGGAAGATTTTGACCCTAATGTTGATTCCTTCTTCGGAGAGGTCGACGATGGTTGCTGTTTCGGCCATCCTGCGACAGGCT
CTTGCTTCGAAGATGACGGCGCCTTGCAAGGACTAAAGTTCTCCGTCTCAATATCCACGCCCTCTTGAGTATCCAGATCATCCTCGTGATTTGAGATCGT
CTCCATCGACTCATCCACTAGGCTCAGACTTTGAATGTTCTCCCTTCGTTCTTCTCGCTTCGTACTTTGTATTGAAGCACTCTCTTTCTCATCGTCGTCG
TTGTCATCACACTCCGAGCTTGGCGTGTCCTCATCTTCTGAAAGCACATCAGAAATGGCCGATTCTCGAGAAACCTTACACATCTCGATAGCTGCTCCAT
TCAGCATCGTATCCAGATCAATCTCTTCATCA