Description :
From Genome Similarity Track
Location :
Scaffold_141:923- 3784
Sequence
2861 bases(100 bases per row)
ATTTGGCTCTACTTGCTTGACAAACCATATTTTTGTAAGCTTCATGGCATCGGAACAATTGGCTTGACATCATTAGAGCTCTTACACCAAAAGATGCTAT
ACAGCACGAGCTCAAGATCTCCTTTCACGATGTCCTTTCAAGATCTCACGCACATCACCTTGCTTGTGTTAATTATATCTAGGTTATAGAGCTGTTTTAA
TGATGAAGACGGCTTACGGCCTTGGATGAAAACCGAAAAGTGAGTTGTATTCAAATAGTTCTTTATCTCGAAACGAATGGCCATTAGAAGCCGGTGACTC
TCAGCCACCGATTTCGTGCCCTGTCTCCACCACGGGTAATTACTTCCTGTAATATTCCTACAGTAAAAACTCTACTACATCCTACAGACGTAGCCGCAAC
ATCACTCTTCAACACTCTCCCTTGATGTGCGTGCAAAGTGTGCATCCTACACTGCCATGCCCAGACCCTTAATGAACTTGATGTACTTGTCTCTTGGGAG
TGCCTTGGTAAATCCGTCCGTGACCATTTCTTCTGCTGGCTTGAACTCGAGCGCGATCACTGCACTTGCAACCTTTTCACGCAGAAAGTGAAACTTGATG
TCGATGTGCTTCGTGCGCGAATGATAAACAGGATTATTGGCCAACGCGACGCACCCTTGATTTTCTTGAAACATCGTCGTCGCTATCTCGGCACAATACT
TCAGGCCCTTGAGCAGAAATCGAAGCCAAATCGCTTCCTGCGTCGCGCTGTACAGACTCATGTATTCTGCCTCAGTGCTTGAGGTCACGACCGTTGGCTG
GCGCTTAGATTTCCACGATATCGCGCTCCCGTTCAGGAAGAAAACGTATCCTGTTGTCGATCGCCGCGTATCAAGGTCACCGGCCCAGTTAGAATCCGCG
AATCCAATAAGCTCTCCCTTGCTGAATCCGCGAATCCAATAAGCTCTCCCTTGCTGAATCCGCTAAACACGATGCTCATGTCTTGGGTCGTCTTCAAATA
CTTGAGAATTCTCTTTGCCGCTGTCCAGTGAGATTTGTTGTAGCGCTCGCAAAATTTCGCAACTTCACCAACCGCATGCGCGATGTCCGGTCGCGTACAT
GTTGCGATGTACATCAAAGCGCCCAATAGCTCACGGTACGGGTACTTGGGTGCAAACGCTTCTGCTTCACGCATCTTCATCAGCTTAGAGTTGCTGGCCG
CCGGAGTGTGCATGTCCTTGCAGTTCTCAACGCCGAACTTCTCTGAAAGTCGCTTGATGTACGCCTTCTGATTCATCTTGATAACGCGATCTTCACGTTT
GCGATGAATCTAGATCCCGAGGCAGTACTTGAGATCATAAATTTTCTATCCGTTGATTGCTTGATCGAACACTGTTGACAAGCAACTATTATCATTGCCC
CGTAATATGGACCTTCTATAATAGATCATCACTTGGCTGTGTCAGTCGAGAAGACTGAATATGTCGTGGACGTATCATGATTGACTGCCAATTTAGTTTA
CGACACGTTCGATCATATCGTGAAAGCGAAGGTGCGTGTTAGTCACAAGAATGCACCATGTCCGTATTTTTGCTTAATACACCGTGAGGTCATTACAATT
ATTTCATGCCTGTGTCGGCGTTGTTCTGAGCGTCACGCGCTGCCGTTTAATGTCTTCGCCTTACGTCAAAACCATCAACGAGAATCAGCAGTAGTCGGCG
AGCGATTTTTAGAAACCTGAAAGATCCCCCCGTACTTTCGTAATGAAGTAATTGGGTGTTGTGTCCGCTTATAACTATGGAAACGAAAGTTGCGGTGCTT
CACAAATACAACAACCAAAGATTACATATCTTAGTCGATGGTCTGACTGCATGATCGTGAGCTGACGTTAGCTCTGCTGGTGATTCTTTAAGAATAAGCG
TCGGCACCTCCACACTTTCCTCATCTTCGATGACATCGAAGACTCTCGTGTCTTTGTTCTTCGATACTTTCGAGACGGGATGCTCAACGAACATCACGCT
TCTTGAAATCACTATCGAGCCGTCGTCAGCGCTAAGAAGCCGATACGCCTTTTGGTCCTTGGCGTAGCCAAGAAAGAAATATCTTACGCCCGAGTCGTCC
AGCTTCTGTCTCTTCTCCTTTGCCACGTGCGCATAGCATTGCGCACCAAACACGCGCATGTGCTCGATACGCGGAGCCTTCTTGAGCACGATCTCGAACC
GGCTCGAGTTCTTGGACGACGCATTCGGCAAAGCATTCTGAATGTCTGCTGCTGTCATTAGTGCCTCGCACCAGTAAGACTTATCGAGGCCACTGTCCTT
GAGTATGCAGCGTGTCATTTCCACCAGCGTGCGATTCATACGCTCTGCCATTCCGTTCTGCTCAGGGTTGTATGGAACCGTGAACTCTTTCTTGATGAAC
TTTGCCTTGCAAAAGTTTTGCATTTCCGAGTTCCGGTACTCCCGCCGTTGTCGCTCTGCAGCACCTTGACCATTGTTCCGGAAGTAGTCTTGATCTCTTG
GTAGAACCGCTTGAAGGCACTCGCAACTTCGCTCTTCTTTTGCAACAGATAGACCGTCACTATTCGGCTCTTCATCATGATGAAACTCACGATATACTTA
AAGCCGGACTTAGACGATAGCGTGATCGGTCCGAGTACGTCAGAGCACACCACCACGTCCGAACGCGAACTCTCCCTAGTTTTAGCATCTTTCTCGATTG
TCTTGAATGACTTGCGCACTTGCTTTGACGTTGCTCATACGTCACACACACTGTTCGACTTTATCTTCGTGTCCTTGATTCTTCCGTCCTTGACCATAGC
GTTCAATGTGTCATACGACGCGTGACCCAGTCTTCGGTGCCATAGCTCGGTCGTGTCTTCG