Description :
From Genome Similarity Track
Location :
scaffold_74:9229- 11902
Sequence
2673 bases(100 bases per row)
ACGAAGTCGAATCTTACGTCAAGCTGTTATCAGCAATGGTTCCGGAGCAATTTTGCCAAAAtagtgcgtagcgctgctacagtctctcgggagcaagaag
gttggagactcggataagaagttgtcgtcgcgactgcgtacACGGTTGCGCCGATATTGTATAATGGcctgctgtattatagcgccGACTCaaaggatac
gccacgaattgtggttccttacGATGAGGATTCGAAGTGCCGTATTCTCTAGTACCTAAAACTTCCAAAAGATCTACCCTCCATTTCACTTTCTTGTGGT
TACAGTCCTGGTGCTCCCGTCGACATATTATTCGGCCCATGTGGGAGTGAACTACCCCTTACTCACCAAGCAGACCTGACAGTGAGAGGCCCTCTTGTGG
CTTGCTCGTGATCTCACTCGGTGATGACGGTTTGCCAACTTTCTTCGGTGTATGGTCGATATAGATACGGGTCAGATTCGAATGCTCTATATAAGCTGCG
CCATAGTACGTAGTAAATTCAACAGCTCAGAGTTGCATCTCACACTTTAGCAGAGCGTACCTCAGTTAAAGCGGATGGTCCAGATGTTGCTTTGTCTCAT
TGAAGCGCTTCACATCTGAATGGCTCGACAAAGCGCAGAGTTGGCGCGGATTTAACAAGTCAGCATCAAACAAAGGTTGGAGTGTATGATCGTCGTAATC
CTTAATTTTTAAAATGGTCCAAGCTAGCTGGATTGCGCATAAATATTAAAGTATCCGTGCATGGAGATACTCAATAATCAATAAACCTTGTCCAGTTCCA
TCTGCTCATGGAGTCTGCATGTTGCTTATGCAGATTGTGCTTTTCAGCCAAAGGGTCTCCAGCTCTGCGCCTGACGCTCAGaatcaaattttaaatttga
tacGAAGTTTAGCTGGGTCGATTTTAACGAGAAAAACTTCATAATGTCCGCTCTCCCAGCAAGCCTAAATTGCGGTGTCGAAAGAACATGGGGGCTTGCA
AATCCTCCATGTTAATATGAGACAGGTTCTCGAGACTTCGAGGCATGCACAGAGATACACAACGCATCATCAATGTATAAGAGCCCTTTGTTCTTGTCAT
CTGCATAAGCTTGTGCTAATGGGGATACCCTGTCTGGCCACCTGTCTGTGTCTGGTCAGTGGTAGAAATGCCCAATCTGGTACACAACACCTTTATTGAA
ATTTTGTCATATCCACTGACGATTGCGGGTCTTGATATAGAAAATGGTCTCCAACAAGCAATATTGGCGGAACCTTTATTAGGAAGCGGCTTGGCTATAC
CCTCACCGGTATCGGTGTTGCTGAACGCAAAACGGTGAAGTTTTGCTTAGACGGTCCACTCGAGCCCATGTAGAAGCTTGTCGACTGATACATGCTGTAT
TAATCACATGGCGTTCACTGAGCAATTTTTCAGGGGTGGACACCATAGATATGTGCCTCGTACAGCATTTTGATTCTAggatcttcatcatcaataCATC
TAGTTCCTTTTCGTACGCTAGTTCAATGCGTTGTCGCAGTCAAAATAAGCAAaatcgcatccgccacagCATTAAGCCAATTTGGCAAGTACCTTACCTT
GTCGACAAAGATTGATAACCGTTGTGCATTTTCGTTAAAGATGTAGTAACGACAGCGCATTGCGCAGCAATGTATGAGTTGTATCGACCGCTTAagaagc
caagcaggtgcactacaaaattgatgaggacattttcattgcaagtagctccttgaaATGAACAGGATTGCCCTTTTCGACCACTTTAAGCTGGCGGGGC
TCAAATGTGAGGATCAGTTTGCTCCCATCGGCATGTTCTCGGGGAACTGCTTAGCCTATCGCAAAGGCTAAAGTTTTACAGACGACATGGAATGGCCGAT
CTGGATTTGGAAGAGCCAGATCGGGGCACCCATGAGGCGTTTTTTAAGTCTTTAAGGCCACCTATTTGACGCCCTTATTAAGGAAATAAGTGATGAGATG
TACTATTAAGGCATATTTTGAAAAGTCcttgtgcaagaagttggTCGGGATAAGCCACTTCCTCCTAGTCCACTTGCGACAGAAAAACTGGTCAATCAAC
ATTGATCTTTAACCTTGTTAGATCTCTCCAGATAAACAGCTTGGCAAGGTTTTCTTATCCACACCGAAGCCAAAGTTGTCTTAATTGACAGACATTTGAT
AAACGCAAATAGCAAAACTTATATTCATTGACAAACATTTGAGAAACGCAAACATATGAGTACTGCGTGCAAATCTTCTATGCAACTCCACCCATCCGAA
TCCTCGTGCCCCGCAAGACTATGGTGATTTTTTCAATGGAAAATAGAATTGTGCAAAGGATCGATGCGGCCAAGAAAGACATATCCTCGGACAATGAACG
TCGCCTGTGCATTAGAAAATCTTTGTGACATATCAGCCCCTCCTAGATAATTAAGCTTGGATGTACCCGGAACTTTTACaagcatttgaaaaaaatatca
tttaGGCCACCTAGGTCAAGAACACTGAACATGGTGTTATTTCTATTTGCAGCACAAAGACTCACGAAAGCACCATGAAACGAGTAGTGTGTTTGGCATC
ATTTGCACCCGCCTTCAGCCGGTTCGTGACGTTCTAGCCACACCATACCGAGGATGAATTTGTATCTCAAAAA