Description :
From Genome Similarity Track
Location :
contig_1:922799- 923859
Transcript NameFunction/comments
g288.t1hypothetical protein F444_02281

Sequence
1060 bases(100 bases per row)
CCTAGGAGGCTTCAAGCACCGTAAAACGCAGCAGCACTTCCACCACGCATCGACACAGGTACCTGCTGTTGGTTTGTGGTAAATTCCTTACAGTTGTGGC
TGACATGAGTGTTTTGCAGACGATTTTATCCAGAGCTCGTCGCAACATGGGCCCCCCACGCTTCCATCGCGAGACACAAACACAGTTGCTGGTGACTCGA
TCCTTGCAGACCCATCGAGAATCTGGCACGCAAATGTCTCGGCGCGACGTCAAGCTGGATGAATCGTTCGACCGGCATGTAACTGCGCGACCGTACTTCG
ACTCGTACCAGCTAGACAGTCTGCGTGAAGACTCGGTGCTACTGATGCAGCGCTTGTGGCGTGGATTTCGCGCTCGACTGTTTGTGTACAACATTCGAGA
GCAGCGTCGTCGCGCGAGTAAACTGGCAGAGATCGAAGCCCAGGAGAACGAGGCGGACGATATTAGCCGCCAGCGCCGTGAAGTAAACCGTCGTATGCAT
CCGAACACGGTGAGCGACTTCGAGGTGCTCTACAATGAGCTGGACAAGTGGCGACTAGTGGAATGCCGCAAGGTGCGCGAGCAAAGAGAGCTGGATCCGA
GTGAGAGGCAGCGAGCGCTTGACGCTATCCTGGCCAAAGAGACCAAACTGCTCCAGACAATCGACCGCCTAAAGTTAACAGCAACAGAAGCAAACCGCAA
ACAGCGCATTGAAGCCATGCTACAGTTCATGGGACGTCCGAAGCAGTGGCAGATGAGTGACGGAGACATCAAGGAGGTTCATACGCCGTTTACCGTGCGT
GCGAAGGAACTCATGGACCTGTACCATGGACTGAGGACGCCACTGAGCTCAGTGGACGAGCGCCTAGACATGCTACTGCACGTTAAATGGACCGTCCAAG
AGTTCGATTGCCCCCTCACACGAGAGCTCGTGGAGCTCATCGACCGCGAAGCTGACATGCTGAGCCGTGGGCGCAAGGAAAAGAGTCTGGAAGGTCTACG
CAAGCGCTTAACGAATCTCTTTCTACAGTTTATCGAGACCCCGGAGTTCAATCCGGAGGC