Description :
From Genome Similarity Track
Location :
Scaffold_135:9226- 16043
Transcript NameFunction/comments
Phyag_g2558hypothetical protein

Sequence
6817 bases(100 bases per row)
ctgcgtctccagccCGCGCTCGCTTCAACTCGGTGGAGCTTCtgctgttcgagctgcaggacgcgctggaccccaactccttcttcgtcctcgcgtggca
gcagctgctgctgctctgcgtcgtctaCGAGATCACTGTTCTGCCCTATCTAGTCGTGTTCAGACCCAGCGGCGTCTCGAGAACCACAgcagaactcgcg
gtcgttTACGTGTGCGAGCTTTTCTTCCTGGCTGATGTTTACGTTGAGCTCAATACAGGGTTCTACGAGGAAGGAGACGTCACACGCGACGCGAGGAAGT
CCCGACGAAGGTATCTCAAGTCGCCCAGGTTCATTCTGGACGTAGCAGCGCTGGTGCCAGTGTCTTTGTTCCCTGTTAGACACTCGGTGTCGATTGCGTT
CTTGGAGATGCACAAGTTCTTGAGGATATGGAGGATTCCAAAGTACATTGCacagctggacgacgtctACGCCAAATATTTTGTAGTGCTCAAGAtgttc
aaggtgctggtgggtatcttgttgttgtcgcaCTTTATCGCTTGTGTTCGGTTCCTGTTTGGGTACGAcgaaactggagaagacgaatGGCTACCGGGCA
AGCCCACGCACGAACAGAGTTTACGCACCAAGTATTTCATGTCGATCTTCTGGGCGTTTGGAGTTATGACGGGGCTGTTTGAAGGCGAGCTCCCACATAC
CATTTTGGCGTTTATTTTCACGATATTTGTGGCGATCTGCGGGTTTCTGTTGTTCACGTACTTGTGCGCCACGTTCTTTATGATTTCCAAGTGCGAAAGT
CAGAACGAAGCGTCTGAAGCACGGATAAACCAGTTCAAGCACATACTTTCCTTTCATCGCGTGCcggaggaactgcagcaccaagcggTTGAGTACTTAA
AGCGATATTACACTTATGCGGAGTCGAATGATCGCGAAGCGATGCGACTCTTGTGCCCATCAATCCAGAAAGACGTACAAATTGCTTTACTGAAGGACAT
GGTGGCAAGCGTTACCATCTTTAAAGGGTGTAGCGACCAATTTATCGTCGCTGTAACCAGCCTACTCGAGATCATTTCGCTACCAGCATACTTTTTTGTA
TTCAAAGTCGGTGAGAGAGGTGACGCCATGTACTTTGTCAACTCGGGTGTTATTCATGTTATTGTGGATGGAATAAAGGTACGTGAGGAGCGCAAGGGCG
ATTTTTTCGGGGATATGAGTATTTTTTTGGACCGTCCTCGCTGTGCCACCGTGATGACTGCAACATATTGCACGTTATACAAACTTGCCCGCTTCCACCT
GGACCGAGTACTCGACGGCTATCCGGAGTACGCAATGTCAATCCCCAAACAAGTTGAAGAAATGGCCCGCCGAATGTTTGAGGGAAAGTCTCGTGACCTG
CCAGGCGCAAAACTAGGATCATCAGGGAAGAGAAAAACTATTGCAAGGCTCCTTCGCAAATCCATCCAAAAAGAAAAACCATCGCTAGCGTGGGTAGTAG
CAAACGCAGTCGCGAACAAGGGACTCATTGTGTCAACTCAAGCAGCCGAAGCAAATGATAgcacagcatcagcaaaaACAGACTTGACAGGCACTATTAC
AACCCCTATTGCGAATGGACCTCAGACTTTATCAATTGCAGACACGGCTGCACCGACCGCCTCTGACGCACCATCGCAGAactcttctgcttcaagcaAA
CGTTTAATAACCTCTCCAGCACTGAGTGCCAATCGATTTGATAGCACGAAAAAGTCGACGGGTCATGAACAACCTGCTGAGATGGCAGTACCTTTGGCTA
CCATTGAAAATCCAGAAAGGAAAACCAGCTTGAAGATGCCACCCGCAATGCAAATGGTAGCGGCACAACTTACTTGGACGAGGGACCCAAAAACTCCACT
TTGGTCTGCGTTACTGCTGCGCAAGGCTATTAATTTTGAATCGGCTCGAAGGATGTGGTGGATTCTCGCCTTGGAAATCAACCTCGTGTACTTCTGGTTC
GTTATCCCGGCCCAACTCACTTTTGAGGTGCTGAATTATCGGAACTGGTTGGTGTCCGTGCTGAATGTGGTGATGGAATTGGCATTATGGGTCGACATCT
ACTTGAATTGTAACTTGTCATATATCGAGAACTCGGAGAAAATTTGGAATACGGTCTCGACAGCCCGAAGATACCTGCGCAATCAGTTTGCCTTCGACCT
GCTTTGTGCTCTACCGCACTGGGCGATGGGATCTGAATTTCTTCGACTATTGCGATTGTTACGAATGTGGCGCGTGAAGGACCATGTGAAAGAAGTTGAC
gaatttcttcatctcgatAACAAGAAGCGACTGCTGCTATTCGGGTGGCTAATGCTTATGCTCTACCATACCGTAGCGTGTTTGCACTTTAGTGTTTCCT
ACCTGGAAGGATTTAGCTCAAGCCCCCACGGTTGGCTCCCGTCGAGTGATTTACAATTGCTACGACTGAATGAGAGCTACTAcgtggacagcgacaacaa
aACGTACGCGGTAGGCTCTCCCGAGATCATTGAAGTTGGATTGAACCAATATTTCCGATCTTTATACTACGCGTGCTATGTAATCACTGCGTTGGGCAGA
CCAGTCGAACCGGCCAGCGATATTCAATTTGGTGTTGCTCTCATATTCATGCTTAGTGGCTTCTTCATCACAGCCATAGTTGTTGATAACGTTCAAAAGC
GGTTCACAGCGTCTGCTTTCGAGCAAAAGGAGTTTTTCGCGAATCGGACACGAATTCAACTCTTTTTAATGCGTCAGAAAGCACCCTTGGCGATTCACAA
GCGGGTGAGTGCGTTCTTGGATTTTTGGTGGTCTGCTCATCGCGGGGCTGCCATCGGATCACTAATGGACGATCTCCCCACAACGATAAAAAATGATATC
ATGAAGAGCGTATGCAAGCCAGCTCTGCAGACGCTAGCTCTATTGGCTGGGGTCCGCCCCGTTTTGAATGAATTGGAGCTGGCATTTATCGACAATGTGA
AATTTGTCCTCTACGGACAGGGTGAAATTATCTATCGACAAGGAGATTTTGCCGATGGGCTATTTTTCTTGCTGGAAGGCGAGATTTGTGTGATTTCAAG
CGGGTGTGCGCCTCGCAGCATACCCCAAGGCAGCTTTATTGGGACGGCGTCATTGCAATTCGACAATAGCTCGCCGAGTTACTTGGAACGTGTGATAGCA
ATTAGTGGATGCATCGTCTTGTTCGTGTCTCGAGAACATCTACGGCTGATGCGAACTACGTTTCCTACACTAGCCGATGCTTTGGCTGCGCTAGAAAATC
GTTTTTTGGATCCCAAGTTCCTGAAGGCGTCAGAAATGACAACcgcgacagcaacatcaagcaGTCGCTCGTTTATTACCACGTGGTTTACTGAGCTCGT
ATTTGACCCCGATTCTGGGGCAATGATGGCCTGGGAAACATTGGTGTTCATTATGCTGACAGTGCAGTGTGTGCTGACCGTTTCAACGATTTGTTTTCCT
GTATCCTCACACACCAATGAGGCATTTGACATCGTCATCTTTTTGATCGAGATCATCTTCATGGTTGACATGTTTGTACGCTTTCGTTTGGGCTTTTACG
AGTTTGGTAACAAGGTCATGGATTTGCGCATCATTAAACGGAACTATTTGCGGTCCCGGTCATTCGGGATTGACGCTGTTGCGCTGCTTCCGCTCTATTT
TATTGACTGGGGACTAGTGGGTCTTCAATACCAGAACCTGGAGATTCTTAACCTGAACAAGCTGGCGAGACTATTCAAAGTCCCGGCACAATTTTTAGCT
CTGGAAAACAAACACCTCAAGTTTACCTTACAAATCCGCCTGTTCAAGTTGGTGTATTACACGTTCATACTTTCTCACACACTGGGGTGCTTTTATTTCG
ACTTCCGCTCACATGTGTCGCGCTTGCACGGTTCATGGAATGGTAAGACGTCATCTGCGGCAACAGTAAATCAGAGTAACGCTCAGTGGCTGCCGGATGA
GTCCCTTCTCGAAGCAGGATTCTCGTTGCAGTACTTTACTTCGCTCTTTTGGTCTTTTGGGGTCATGTCCGCAACATACCCAGGCGAGCTTCCAAAGACC
ACATCGCAGTGCCTGTTCAACACAATTACCCTTACCTTCGGTTTTTTCCTGTTCGCCTATGTGATTGGAAACTTCTCCGATGTTATTGAGCTCATGGATG
CGGAAAATCGGGAGTACTATGCTACGCTCAGTTCGTTCAGGCATTTGCTGGAGCATTTCAGACTACCAGCAGCCATTCAAGAGCGTTACAaggctttctt
cttctttaaGCGTTTTCACTCGATCACGCAAGAGCATCTACTTGAGAGCAGCCTTCCTCCGTCGTTGCTGACAGATATCCGCATGGTTCATCTAAAGCCG
ATGATAACGAAGGTGCCGTTCCTGTCGGGAATGAATGGTAGCGTGACACGAATGTTGGTTTCGCATTTTAGCCAGGTCATGGTTGTCAAGAATGAGTTCG
TCTACAAGTACGGCGAGGAAGGCAGCGATATGTATTTCGTGTGAGTGTATGTTTGTTCTGGATGCAAGACGCCTGtgtacacgtccaccaccaaatTCGA
CTCAGATGCGGCTGGCCTGCATTCTTAAGTTTGGTGTTTAGTTGAGATAGAGTAGCAAATTGCTGATTTTTGTTTTATTTTTTGTGGTTGCAGATATGCT
GGCCTGTTGGAGACCTTGATCCCtcgcgaggaggagctgaagcaacGGGCGACCTTGACTGCGCGTCGGGAATCACTTCTGCGCAGAACACCGACAGGCA
CAGCACTCTTAACGAAAAGACCTAGCATTAAGCCACTACTCTCGACCCGCAAGGTGCACCCGCACCAACAATCGGAGTGGGCAGACGACAAACTGGACGT
TCAAGAACTGTCAAAACTCAACGAAATTACTGCCGGTGACTACTTCGGCGAAAATGCGCTGTTCGTGGACAGTGTCCGGAACGCTTTCGTTCTGGCAAAC
TCAACATCCATTCTCTACAAGTTGTCGCGAAATTCTCTCGAGACGGTGTTTCATCGCTACCCGGAGTGGAAACAGAAAGTATTCCGCGTCATTAAtctcc
aacaacagcaactgcGGCTAAACCACATTTCCAAGTTGGAGAAACACAATTCGATAGGAGCTGCCATGACAGAAGAACATCACGTTAATGAATACGCTGA
AATGATGGAGGAAGCAGTCATATCATCTCGATACAAGCGCTCCAGTGCGGCTACCAGCGCAATTAGCAGGCGAGAAACGCAACGGACCGGAAgaccagca
tctccacgcTCAAACAAACTTGCACCGAAGTCACAGAAGCTGCACTGGCGAATACTTACGTCAATTACCGTGTTATTCCAGGGTGCGTCTGCTCAAAGTG
CGTGCCACCTGGCGTGGACCAAGGTGATAATCTTTGCCACCCTGCTCATGTCCATCGTTGTGCCTTACCGCATTTCATTCGATTCAATGGAGCACACGGA
GTGGCTACCGTTGGTTGTGCGTGAAATCGAAATTGTGTGTGAGGCGCTTTACATTGCCGACATTTGGGTAAATTGGCGTGTCCAGTGTTCTAGCGAGTCC
GTAGACCTATATGAGCAGGATCACAAGGAAACTTACAAGAGTGAAAGGCTTGTGTGCGATGTTTTGGCCGCAATCCCTTTCGACTATATGTTGTCTAGCT
TCACCAACGCGCCACTCTTTCGAATCAATCGTTGTCTGAAGCTTCGGAATTTCTTGCATTACATGGATGAAATCAACCGGAGCAGTATCCACAAAGAGAT
GCACCGCCTGCGAACTGCCACTGCGCTTTACGTGCTGGTGATGTATTGGGGCGCATGCATGTACTTTGCTATCGCGGTATATGGTCATTTTGGCGACGAG
TGGAATGCGTGGTTGCCCGATGCCAGCTTATCCAATCCAGAAGGCAAGCGCACGCTAAGGTTGCTGCGGGGGTGCTTTTTCGCTACGACGTCTTTCATCA
AGAAAGGGCGTACTTTCAAACCAGATACAATCTTCCACTTTGTGTTTTGCATCATTGTATGCTTCGTTGGACTGCTAACGATGGCATTCATGATCGGAGA
ATTTGCGAATCTCTTTATTTCTTACATCACCAATGAAGTGGAGTACCGGAAAAACCACATCGCAGTTGAAATGTACTTGGGGCGCTGGAAGATCACGGGC
GAGCTTAAGGCGCGGACGCACGCCTTCCTTTCGTCCTTATGGTCTTCGCATCGCGGTGTAGACTATCAGTCGTTTCTCGAAGGCGTCCCGTCGTGCATTC
GTACGGAGTCAATTCTCGTTATCGCGAAGGCTCCGTTGAACTCCTTTGTCGGTGATATATTTCATCCTCTTCCGCGTGTGGATCGGCTCAATGTCGTCGA
CAGATTGATGCAAGATATTGCACAGCACCTGAGGTTTGAGGGATACCCCCGTGATGAAAACGTATTGGTCGAAGGTAGCATTACCAAGGCCATGTACTTC
ATCGTACGTGGTTATCTCTTCTCAACGAGCGAAGCGCAGTCGAATCGCGGCAGTAGTTACTCCAAGGGCACGTATTTCGGCGATAAAGGTTTGCTCGTCT
GCTCAGTCAGTACGTGCACTATTCGTACGTTGCGTGCATGTGATCTGTTTTCGCTAGCTCCcgatgcgctgctgcgtgtatTCCAAAAGCACCGGGTGGC
AAAACTGGCATACGAAATCGCAACACAGGCCGTGCAAATTGTCAAAATCAAAGATCGCGTGGCATCGAGTGGGCCAGTGACGGAAACTGAGTGGGGTGAA
GCGGTGTTGGGAGCAAT