Description :
From Genome Similarity Track
Location :
Scaffold_720:9226- 12448
Sequence
3222 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCATATTATACAAATCCGCCATGAGCACCTGAAGTTCAGAGCTCAAACCCTTTTGCAG
AAACATGTATTAATAAAGCAGTAACACATATTGCATAGTGCTATTAGGCTTGCCAAAATTATTGTGAAAGACTTTAGTAATGCTATTTAAATGCTCGAAG
TGTAATGCCAATTAAAATGTGCCACCTTAATTTTGTTTTTATTCATAAATTGATATATCTATGTATTCTGGCGGATTACTGTCGCGATAATAAAAAAGTA
CTAACGTTACTATGAAGGATGGCACTCAGATGGTGGCGGATACCGTCGTTGTCTGTATTAATAGCTGATAGTGGTGTGAAGGTTCAGGCGCTGAACCTTT
GTGAACCTCCCGTTACCTCTGCATCCGGAGGTACCCCTGAAAGGTATCTGAATCCCTTCAAACCTACTTCAACTACCTTCTACATCCTCAATGGTACATC
GGCGTTAAACTATGCACATACTTTATTCAAGTGTTTTGTTCGTGCTGTGTGTTATCTGAGAAGGCGATCATCATTTTCCGATACCTATGGAGGCACAGCA
GCACTCGCGGCGCGAGTCGCGCGGCCATCACACGCCACGTCCTCTCCGTACGCCAGCGCCTCGGCGTGTGCTTTCTTACGATGACGAAGTGCCTACTGCA
GTGCCAGCTTCCGTCCCGGCTCAACCATCGAGGTCGTTCTCTCGACAATCGCACCAGTCCCAGCAACAGCTCTCGCTGCAACCGCGGCCACAGCAGCTCT
GGCAAGCGCAACCTCTCCATCTCTGGCAAGCACACCAGCCACAGGTGCAGGAGCGGCTCACCCAGCATCCACAGCAATTCTGGCAAGACCGACAGTCACA
GACGCAGCACTGGCAGCATCAGACACAGGAACAATTCTGGCAATACCAGTCGCCACAGCAACCCCAGCACCCATGCATCCGCCCTCCTGTTCTCGAAAAC
GAAGGTGCCGTCATTGACGTCCAGGTACTGCAACAGCGTGCTGAAAGTGAATCGGGATTAGTGCTCTTTACTACGAAGCGTCAGAAGAGGAGAGATGTTT
GGCATTTCGCTCGGCTCATTCGAAGCGAGGCGTGCAGACAAATTGAGCGTAATGATTTGAATAACGATCATGCCGAGCTCGCGTATTGTTTACTTTGCAG
TGCAAAAGTTAAGTTTCGTGTTGGTCAGTCGAAGTTGCCGCAGCATATGGAAATCTACCATTCTGAAGAGCTAAAGGTGTACAACAGCAGCGAAATCAGA
GCACAGGCCAAGCTCCTCTTCATAATGGAAAAAGGCAGTTGCGTACCATTTCAGCGGAGCAACAGAAACGCGTAAATCTTCTTCTTGCTAAGTGGATCGC
ACGGCACTTTCGGCCGATGAAGATTGTGGAAGATGCTGGATTTGTCGTATTTATTCGATACATTACCGAAGATATTTGTGGAATCAAAATAAGGCTTCCT
GAGCGAACTAAGATCGCACAACAAATAGTGGCTTTGGCTGTGGAGTATCGAAAACGAGTACGACATGCCATTGTGAAGGGATGTTGGTATTTTTCAATGA
CCTGTGATATTTGGACTTCCAGAAACACGAAAAGCTACATTTCGTTGACTATACATTACGTGGACGATGAATTTTGCCCTCAGAATTGGACTCTGGAAGT
TAAAGAGCTGGCCGGCATTCATGATGGACCAGCCATTGCAGACGCGATTGAACAAATTATGGAGGAATGGCAGTTGTCTAAGCTCTACTGTGTCCGGTTT
TTGAGAGATGGAGGCACAAACATGGTTGCTGCTGGTGAACTATTACATGTCGAGCACATGTCATGCCTAGCACACTGCCTGCACCTAGTCGTTGGAGGGG
CAATGATTAAGAAGAAACGGGC