Description :
From Genome Similarity Track
Location :
Scaffold_7:922415- 924368
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05313hypothetical protein

Sequence
1953 bases(100 bases per row)
TACAGCTCTCGAGAAGAGCTGGGACCTCTGCTGACGCCACTCAATGAAGGATAATGTGAGATGGCAGCGAGAAGCAACAAGCTCTGCTAGTTGTCGCGGT
GGCAGCTCCTTGAGCTTCCCGACGATCGTGTCGTAGATGTCCGACATGAACTGCTTCAGAACTACCAGTCTTTTTCTCTGCTCTCGCGATGCCAACACAG
GCGCCAAGAGAAACTCGGTCTCTACCATATCTTGTCTGGAAGCAGGATAATACATGGCAGAGCTCCATAAACTGTCATCCAGATGCAGCTCTGCATAGTT
TTGCAGTCGCATGGCTTCGCGTTCCCCGAACGGAATGTTGAGGGCATCGTCATCATCCAAAACGTTAGCATCAACCTTGGAGTCGATATCTGTTTGCTGA
GCCACATCGATATTGTCATTTTGGGTCTGATCCAGATCATCCAGTAGATCCGTTTGAGCCGCATCGTCACAATTCGCTTGTTCGTTAGTGTCTTCCGGGG
TCAGTTCACTGTCACTAACAGAGGCTTCCTCCTGGACCGTTCCTAGCACGATATGAAGCGAGCCTACAAGAGCTTGAGCCTCCTGCATTGTTTGTTGGAA
AAGCTCAACGTCTTCTTCATCCAGTGTTTCTGATGGAGCGGCACTAGCTGGTCTAGGAGGTAAGTCTCTCTGTTCCTCAATCGACTCGTTCTCAGCAGTG
AGAGTAGTGTCATTACTCTGATTATCTCTACGATGAAACATGGAAATGACAGACGCCAGCTCACGGAACGTTGTAAGCAGCCGGATCAGCGTTTGCCTTG
GATTTGGCTTTGTATCTACTTCAGCCTCTTGTTTACCTTCTTCCTCCTTGTTGACTTCTTCGTTGTTGTTCTCATTCGATACAGGTGTCTCCACTTCGGT
GATCGGTTCTGGGTTCTGAGCAAGTGCAGGAATGACTAGTTCTAGTTCATTTTCGTCGCTAAGTTTCAGCATGCTCACTGAAGAGCGTTTAAGCTTAGCA
CTGCGGCGGCGATCAAGCAGATACGCCCGAACATTGGCTTGCATGAGTTCAACCGCTGCATTCTCTTCGCGCCGACGCAAGATAGTTCGCATGACTGCTC
TGCGGTGCAGTGCAAGTTGCCGGTCCCGAAAGCCTCGATATGAACGCTGGATATCCATTGCCGCCGCCTGCTTTTCCACTCGAATAGTAATGCGGGTTTG
CTCTTTCCGTGCCTGGTACTTTTGGAAAGCAGCCTGCAATCGTGTCGCTGCCAAAGTGAGCTCTTTGGTCGAGTCGCGCTTTGAGCTGATCAAAGGCCTT
TTGATTGACGCAGAATCGCGCCGCCGTCTCCACTCTGCTTCGTCCTCATCGATATCGCTTTCACTACTCTTCTCTTCATCGTAATCTCCACTCAACCGCC
TGCCTGTTTGAGTTCGAGCCTTACGCAACTTAATCGCCTCCTGTTCTGCTGTTAGAGGAGGGCCAGTCTTCACTTGGTGCTCTAGCTCTTTTATTCTCTC
CATAAGTTGCTTTTCTTCTTCTTGAATTCGTCTGAGTTGTGTATTTAGTTCAGCCAGTTGGTCTTGCTGTTGATTGCTCTGTTGATAGACAACCTCTAGT
TGATCGATAAGGCGAGCCACCGCTGCATCATAACGTTTGCGAATCTCATGTAAGAGTTCACTTTGCTCTTTGCAGATGCATTTTATCTGCCGCGCAAGCT
CATGGAAGCAGTATGAGTAGATTTGAGTCTCTTGACTTGTGTAGTCAAGCACCAAACGTCTTCTTTCAGCTACGACAGAGTCTGTTTTAGAGCCAATATC
TTCACATTTCTCCTCAAGTTGTGGCATGGTAGCACGCATTTTATCCAGTGTTTGTCGAAGATGCAGCACTTGTTGTCGGTTGTGCGGTGCCAGTGCTGGA
AAGACGACAGTCTCCCATTCTCCCTCCGTATTCAGAGTTGACTTGTACTGGTG