Description :
From Genome Similarity Track
Location :
Scaffold_1122:922- 10324
Transcript NameFunction/comments
Phyag_g9572hypothetical protein
Phyag_g9573hypothetical protein PHYSODRAFT_552333

Sequence
9402 bases(100 bases per row)
CCTAGTGATATGGTGAGCAAACGCACCAaggagcgacgacgagcgtcTTTGTCGTTCCACCCTTCTGCAATCCCAGTTCGACAGCAAAGAAGCCATAGTG
ACACCGGAACCTCAACCAAAACCAGCGAGGTGAGCTCTGCTGAGATTGTTATCGACAgctcgcagcttctgcgGACAGCTAACGATGGCGATGTCGCCGC
AATGGAAGAAGGCAAAGGCAAATACGGCAAAAAACAGAGCTTTGCGATGATGTCGCCCCGATTGGATGCACAGCTCGGCGGCTACCCGCCAGATTGTGGC
ACCAAAGAGCTGAAATATCTCTCGTACGCTAAAGTGCTCCGCGATCGAGGAATGACACATCCAATGCGTTACTCCAACACTCGCGTGGATGCACTGGGTT
ATGCTATGCCAGAGAGATACCCGTTGTGCTCCACCGACTTTGGTGCACACTCTTTCTACCACCTACCGACAGACTCGGTCGTGCTGAGCCAGTATGGGCT
TGGAATTGCGCTTTACTTCAAATATCTCAAGGTCATCACGTGGctttttctcctgcttgtgGTGATCAGTGCTCCTGCTCTAGCAGTTTATATCGTAGGA
GGCGGAACTTCTATGGCAGAACTTACTGCTCTTGCACGTCAGGATCTGCCGTCCGTCTTGGGTATCACTAGCATTGGTCATCTTAGTGAGGCCAGCAGTG
TGTGTGACCAAGCACTCGAGAGCACGGAACTGTCGCTGACATGCCCAGCAGGTGAGATCGGGTTTGTGAAAGCGGTATATTCGACATACGACACTCAGgg
aagctgcacgtgccCGGAGCGCAACAAAGTCGCAGAAGGTTCTGGTACCTGTCGCGGCGATGCGGACGGATCGGTTTGTCCAGcggatggagctggatgT
TTCCTAGGTGTCCATCCAGTCTCGCTTCGACCTTGCTGTTCATTTTCACGAAATGTTACAACAAAGACGCCGCTCTTCGACGATATGCGGATCCGAGAAA
CTGAAGGTTGCGGCTCCAACATGGCCCAACAAATAGTCGAAGGACTCTGTTTGGGTAAGAAGAGCTGCGCCCTCAATATCAGCGAGGATATCACGTACGT
TTGGGAACCCGATGTCAATTACGGAACAACCTGCTCGAAAGCTCCTACGATCGTCACGATCGACAGCGTCGCTAACATCACTAAGGAGGTGTGCGAGGTA
CGACTAAATGATGACAGCGAATACTCAAAGTGTGGCGCCGGTAAATCTCGAGCCTTGATTGTATACGGACGGTGCTTCACCACACGCGTCGACTTGTCCG
GTGCATGGAGCCTCAAGATTATCGGCTGGGACTCCATGAGCGTAAGGCAAATTTTTGCTTTTGGCTTGATATAGTTTTCATTAACAGGTTGTGATGTAGC
GGCGTGAGTTTCTAGGACTTGCGGTAGGATGCGATATTGCATGTAGCCTTGTGTTCTTCGGCGTTGTAATTTGGCTGCGGCGAAAAGAGAAAGAAGCTGT
TGACCGCATCACCCAGGACCAGGTCAAGGCTCTTGACTACACTGTGCAACTTGTCAATCTACCATACCATGACGACCTCAATTTGCTTCGTCAGGAGGTA
AGTATAAGCCTCGTCAAACCGTTCGTAAAAATTCTAACGCAGTTTTTTTGTCGTGGTTAGATCCGCCTGCACCTCGAAGCTGTGCTGAGCAACGCTTCAC
CATTCGCAGTGGATCTCGATCGTATTCGCGTTGCTGACGTCCAATTCGGCAAAAGTGCATCGCGGCATTTACGTTTACTCAAACACCGCGGAGTtgtcgt
ccaccgtcttgagGTCGCACAGCAACGGCatgagaagctgaagctctTGCAAGGACGACTTAATGAAAACGTGTACGCGAGACGTGAGCGACGTCACCTG
CGAGCTATGCACAATTGGGAGGTGAAGTTGCATCGTTTTAACGTAAAGTTGGAAAATTGGCACGCCCACCACAAGCGATACAACATCTCTCAAGCTGTGA
CTGCTTTCGTGACGttcgaagaagaggaaggttTCCATCGCTGCTTGCAAGAGTACCCAGATCTCGGTTGGTTCCACCGCCTTTTCCAGCCCTACTATAA
GCGGTTGCATGGCAAACGACTGCGATTTCGTCCTGCTCCCGACCCGACCGATATCATTTGGGAAAATCTACATCACTCGTTCCTCGACCGGGTGCTCCGA
CAACTGGTATGGTACAAAATGAgttttgttgctgtcttGATGCAAGAATACTCATGATTGTCCGTATTTGTTTGGTAGCTCGTGGCATTGATCACTCTAG
GTGTGTTGTTCGTGAGTTTCATATCCATCTTCGCAgcgaaggagcagaagaGTAAACTTGACAGACAATTCGAACGGCCAGCCAGCTGTCCGATGAATGT
TCTCAAGACGGATGTCATTCAAGACGAGATAAACAAGGTTTCTGGTCTTGTACCATACAAGGCACTCGTCGAGTGCTACTGCAAAAACTACCTCGTTGAT
CAGTACGTTTTCACCTCGCGAACTTCCATAAGCTGGCAAAAATCTAACTTCCTCTTTGTTACAACAGCTCATTCCGAAGTATGATGTATGAAAGCTTTCA
CAACCCGGAAACGGGGCAGGATGACATGCTGTGTCGGTCGTGGGCAACCACGTTTCTGACGACCCAGATCCTGTCTATCGCTTCAGTTCTGCTAGTTGTG
GCTGTCAACTTGATCCTGGCGCGAATTCTTAACGGACTTGTTGCCTTGGAGAAGCACCACACCGAGTCTAGCCTCGTTGTATCGCGCATTACAAAAGTTT
TCCTCGCTCAATTTTGCAACACAGCACTATTGATGCTTGTCATCAACGCGAATGCCGACTATTTCTCCTCTGGGGAGACAGGAGCCAGCACTGGAGGTTT
TTCACTGGGCGCGTTGCACGTTTTGACCGGAGAGTACTCGGActtttcagcagcttggtaTAACGACGTTGGTGTAGCGCTCATGCTCACCATGATCATC
AACTCGCTCAGTACCCACGCGTACCTACTAGCAAACTACACCATGCTCAAAGCTCGTCGCTTCATGGATCGAGGATTTTCTTTCGATCACTCGCTCACAA
AACAAGACACGCAACGTGATCTCGAGGCGCTATACCGCGGACCAAAGTTTGATCTCGCTTCACGCTACGCACAGTCGCTCACCACAATCTTCATCACGTA
CATGGTGCGTCTGCATTGGAATGTTTGACCCCTTACTAAAAAAGCTAACCTGTATGACTGTTGCAGTTCTCAGCAGGTATGCCGCTGCTCCATTTTATCG
GACTTGGTGCAATGATCATGACGTACTGGGCCGACAAATTCAGTAAGTGATCCTCCAATAGCATCTCTGCACAACCACTAACATGATCTTGATGGCTTCA
ACAGCATTTCTTCGAATTGCTCGATCCCCACCGCTATATGACAGCAAGTTAGCCACGGCGGCAGATTCGCTGCTTCCTTATGCAGTACTGATTCATTGCC
TCCTAGCTCTGTGGATGTTCTCGAACGACCGCATCTTCGAGTCCGAAAGCGACGAAATCTTCGAGAGAGCGGTTGTAAACAGCACGAGCAGCCCTGGCGA
TGGCATTCCTCTCTTCGATGCAGCACGTCGCGGTCAATTGATCTCTCGTGTCACGCGTCCTCAAGTAGTGGTTCttttcgccttcttcgtcgctggttGT
GCCATCGTGGTCATGCGCACATTACTTTTCGAGTATGTGCCAGCCTTCGTACGCAGCATTTTCCCGGCCTTCGCTCGTATGTTGGAGACGCCTCGTGTTG
CCAAGGGAATCCCAAACTACTTTGATGGTGAGTCATCGTCATACTGATACATGATAAGTTTCTGTCTCTGATCTTGTTTCACTCCACGATTGCAGCCATT
CCGACTTCGTGTCTGCAGGAAAAGttggcagctgcaggtggcacGCAGCATTTTCTGCGATCGGACTTGCGTACCAAGTACGAATGCGCTTTAGCAAACC
GcctcgctgaagaagaaacttTATCAAAACTGGGTTTGAAGCGCTCCACGTCCGCCATTCAGCGCTTCAACCAAGCAAACTTAATCGTTGGCTGTCCTTC
GTACGGTACGTTGATGATAGTATATTTTTTGATCTTCAAACTTGTGTCTAATGCTGCTCACGCACAGCCATCAGCGACAACAAGGAGTACGTCGCCAAAC
TCGCCATCGATTCACACCTCTCGGAAGAAATTCCACTCGATCGGATCTTCTAGAAGCTTGATACCGTGTTGAACATAGAGATATGGTACACGCGATCGAC
GTTTATTAGCGGTTTATTTTGCCTTCCTCGACATTttttgcttcagcatctAATACAACGTCTTGGGGGATGGAGAGGATCCATctgcagttgacgacga
cggtgacggcACCCGCACGCCAACGTCTGAGAGATCTGACCTCTGCCCTGCACGTGTCTGGACTCGCGAATTGCTGCTTCGGTAGGTTCCCAGCGCCATC
TCCGACTCTCCAGGACAGTGTGAGAATGCGAAGCCCGTGTTGCGGCGGACAAGCCGCggcgactccaccaccacagcggcGTCCTCTCCCTTGGCCAGGC
GATTCCACTCGCGCATCAAGTGCGACGGCTCCGGGTAGAATAATACTCGACCAGCCTTAGCGATGTAGTTGGGTAAGACGGCAACGATTGCTGACAATAG
AAGGCCTAGCCAGAACCATGATTCCCGCACAAGCTCGCCTACTACGCCGTAGCCCACTTCTGTATCGTAGAAGTCGGTCTTGGTCCATCCGAATACAGCA
CAGAAGAATGCAGTAAAGAGGTAGTAGAACACAAGAGTGCCGACAGTTGAAAGAACGTTTGCCCGGGTCCAGTTGCTCGTCATCAGAGACACTTGCACAG
TCGAGGCTGTGATCAGGTACGTGTACGACGCGACACCGTTCGCCCACAGACCCAAGTCGCGTTTGTCAAATGTGAGCTTCGATGAATTACTCGAGAAGTA
CCATACGATGGAACCATTTGTGAAGAACGGCACTGCATACACTACGTAGGCATGCCACGCTCCCAACACACACCAGCCGAAAAACGACAGCCAGTTAAAT
GATCGATTCTTCAGGCCGTTCACGTACAGCGTTGGGTACTGCATCAGCACTGCAGGAGACACATCCTGGTTGTACATTGCAATGATCACGATTGGGATCG
TCGTGAACAGCGCGTTGTACAGCGTGAAGAAAATGCTGAAGTACATCAGCAAACCACTGTACAttgtctccatcgccaagtAGAAGTTAGACATCGACAG
TGCCACATTCTTCATAAACGAAAACAGGATAAGCTTGGAAATCCTCTTGTAGCTGTAGTTGCCGTGCACCAAAAGGAGTCGTTTCAAATACTGGAACTCT
GCGATGGAATAGTCACTGGACAAAACAGCTTGACGGCCCTCCTTGCCACTGATACCGACACCCACATTTGCAGCCTGAATCATCGGTACATCATTGGCAC
CATCACCAATGGCAAGGGTAATATTACCTGGGGAGAACATGAGCGTGGGTTCTGTAACAAGCTTCACCACTGATGCCTTTTGAGCgggcgagcagcggca
gcaaatAACAGACTTGCACTGCGTAGCCACTGCCAAGAAAAGGTACTTGATGTCATCATCAAGCACCAGCGCAAGCGTTTTGCCATCGATCACCATGGCA
AACTCCAATTCCTCATCCACGTATTCGCCACTGCTCATGCTGCCAGTGCCACCCATCATTGCTTCCGTTTTTGGCTCGAAGTCGTGATCGCACAAGTCCC
GGTCAAAGCTGTTCTCAGATAGTTCACGGTTCGGCATGGCCGGATACACCTCATCGTAGTGATTTACGGGGCTATCTGTCGGCGtgtcagctccagcacc
agcgtgcTCGCGGCGTGGCAGACGCCTCCGTTTCTTTCTGGcctcagcttcttcgtcacgTCCCACTAGAGCCAGCTTTACAAGATCCCACAGGTACAAA
ATCGCTCGCTTCAAAGCTTCCCACAACACACTAACCGCCGACGAGGTTTCATCAGATCCCCACTTGTCCTCTACCAGGTCGACGTATAGCTCCTCCAGTC
TTGTACGCAAGGAACCCTTGTCACGCTGTCCCAACACGATCACATCCATGTTGTCATCAATCACATGCGACGACATGCCAATGCTGAGAGCAGTTTCCTT
TTTGTCACCCGTGAGCACCCAAAACTTAATACCGGCTTTGCGTAGGGCACAAATCGATTCTTCCACGCCATCCTGAAGTCGATCTTCAATGGCTGTCGCG
CCGAGCAGTGTCAGCTCAACCTCAATGATGGCAGAAACCTTGGCAATCTTTGCAGCACGCCCCTCCATAGAAAATTCTGCCTGCCGGTACAATTGGTTCC
ACTGATCATATTCTTCTTGCGTAAGGCGGCGCATAGCTGTCGTCAACGTTCGAAGGCCTTCTGATGCATATTCCTGGAGGTGACCACGCGTCACGTGCGC
CACACCCTGAGGCTGGGATTTCGAGAGCAGATCAAAAATTACGTCATCGGCACCCTTGCAGTACAGTACGATACTCCCGTCAGGGAATCGTACGATCACT
GACATACGTTTCCGGTCGCTGTTAAACTCGAGCACGTTCAGAATTTCAAACGACATGGGTCTGCCCTGGATGACTGCGTTGCAGACTGGGCCGTCTCGTG
AATCCAGCACGTAGCcgagatcagcagcagccaataCCAACGCCTCTTCATCGGGGGAAGACGCGTTGTACTTGATCGTCGGAGTTTCAGCCGAGCAGGA
ACCACTACTCGAAGTGGGTGGCGATGTGGGGACGTTGGTCTCCGGGATCACAGTGTTGCAAATCGTGAGCAGCAATAAGAAATCGTGGATTTCCTTCTTG
GTTGAGTGGTTTGAGTTCAGTCGCGCCAGCAATCGACCGTCATTAAACCGGGTGCCAGGTCTTGGAGGCTTGGCGGGGTCCACTTCGATGTCGTTGTAGC
GGAGACCGCCGATGGTGCACTTGGCAAAAATCATTTCGTTGCATGTGAGCGTGCCTGTCTTGTCTGAGAAAATGTACTGAATCTGTCCGAGATCTTCGTT
GATGTTGCTATTCCGAACTTGCGCTGGCGTATTTGTCTTGGCGTCATACATCTCCAAATCGTTTTCGATGTAACGCGCGTGAACAAAACGCACGCCCTCC
ATCGTCACGTACATCGAGAGCGGAATCAAATTGTTAAACAGGATCACGTAACTCAAGAAGATGTAGCCGTTCGAGTCTTCCTGAATATACCATGGAGTCC
TCTCATCTGCCAAGTCCAAATTCCAGTTGTTGTTGCCTAGCGTGCAGGCAATCGAAATTCCGAAAAGCAGCATCAGAACCAGCACGAACATCGTATCCAA
CGTCTTCTCGACAAAGCTACGCTTCAGCGGCACGGCAACTGAGTTCATCTGGACCTTGGTCGATTTACCCGTGTAAATCACAAGCCCCAGCGTCCACTCG
GCATTTCGGCTTTCACTGCCACGCAAGATCAAATTATCCATCGTCAAACTGGTCTCGTTGTCCTCCTTGGTGGTATCCGTAACAGCGTCATCGGCAATCT
TTCCCAATCTTAAAACTCCGTCAAAGTAAAACAGATCCTTGTTGGGCACATCGCACTCCACCTCAAGTGTATGCCGTTCCAAGATTTCTTCAGCAGTCAG
AAAATgcttcgtgcagctcgcaaCCTGGCGGATCTTCAGGTTCGTCTCGCCATCCAAATTGGCAGTCTCCACATAGCACCGGCCATCAGGTCGGCTCGTA
GCCAACAAAATACAGTCCGCAGGAACCTGATCGCCATCCTTCAATAACAGAACATCTCCTACCTCAATGTCTTGCCACGTGCTGTCGACGTGCATCACTT
CATCGTGCTCGTTGCGCCGAATGATATGCGCCGGTCTGGAATTTACCATAGCATCCCCTTTCTGCCGACGCAGGTCCTCGCTCACATCTTTCAGTGCTGA
CGTCGCGAACACAATCAGCAGTGGTGTAAGACTCGCTACGGGGCTCACGGGCGAAAAATCAAAGAAacacagcgccaccacgatgGTCGTGTACAGGTTC
GCAAGCCGGCTGAACTGCATCTTGAGAAAGACGAACAGGAAGTTGTAGTACGTGTACTTGCTCGTGATGATGAGGTTGGAGCAGAACACGGGTGCTTCTT
CCTGtgcctccgcctccttcctccgctgcttcttggacttcAAAACATCCGGCAAATTCGCCGACACGCCCGACTGCGTGCGTCGCATCCTGCTATTCGG
TATCCCTGGTCCCACTACAATCTTCCGTCTCGCCGACGgaccttcgtcttcttccatCTCAGCCGAAGGGTTAATAGACAACGTCTGGTGCATGGAATTC
ACCCGTTGCGGAGACGGCATCATCGTTGCCAAAGCTGCACGATCACACTCTCTCTGATTCTGCACCGCCTTGACAATCcgtcgcagcttccagccgTACA
TGAATCCCGTAATATTGAGCATGGTCAGCAAAATAGAGAAGAATCCCTGCATGAGCACAGAAGTACCGCTGCTGACACTGTTGAGCTTGCCATTGTAGCC
CTTGTAGTACCAAATGACGTCCACGAGCAACGTGAGCTGCATGCCGATCTTGTAGCTGAGCAGGAACTTGGGCACAAGGAACTTGGTGCCGTGCCAGCCC
AGCACCAATGTGATGTACAGGATGAGCACGGGGACTGTGGCCTGGAAGCTCAGGCCTAAGATAATGGGGAAGATACGCAGCGAGTTGATGATGGTCTGCG
ACACGATCGTGAACTTCAGGCGGCGTCTTGTCTGGTAGATGGTCATGCCCTTGAGGAAGCAGAAGACCTTCTCGAAGAGGTTCCACAGCTTGGTCTCTGC
ATTCGGCTTGGTATCAGACGCGACGGAGTCTGCCATACTGTTGGAAATGAATTAGAAATGTCAACAATAAAAAAGAGAGATTAGTTCATCATGAAGAGCG
ACACACTttcttcatttttttttttgccaCTTGGTTTAGACAAAAAAAATGACGTGATTGCGTACCTGTCGGCGCGATACCGCAGCGAGATGATGTtgcg
ctgctcttcttcgttggcCATTCCGGTGAACGTGTTGACGCGTCGGAGGTTTTTGTGTTGCGAGAGCGGCTGAGAAGGAGGCAGCGTGGCGGAGGAAGGA
GCCGCCGCTGGCCCCGCGCCGTCGCCTGAGGAAGGCGCCATGTCCAGCTGGTAGTCCGTCGAGCTGTCGGACGGCGAGGGTACCGCGAACTCGACGCGCA
TCTCGAGCCTTTGGTGAGTGACAAAATGCCCCTTGCTCCCTCGCTGCTTTCGGCTGCTATTCTTGAGTCAAAAACTGGAATATGGGCCGCCGCGCTGGCT
TC