Description :
From Genome Similarity Track
Location :
Scaffold_103:922- 3307
Sequence
2385 bases(100 bases per row)
GATGATCTTCTGGTTCCGACCCACTAAGGTCGGATTCAGATTCAGTGCAACTGTATTCAGCTCGTATCATTCTCACTGCACGCGCGGTCTTGGAAGGTGC
CAGAACTGTCGTTGCTTTCTGCCGATACTTGGACGATCCCATCATTGCTTTCCCGTGGCGCGATCTCCCCCGTTGATAATCCCGCAGTGTCACTTCCATG
GATTCTGCGCCTTCTACATGTAAAAGCAGTAGTTGACCGGCTAGATTTTTATCGTCCAGAGTATCGATGAAATGGTCCACGTCTTCCTTACACGAAGCTG
GCGATCCTGTCTTCACTGGTATCTTCGCCTGCATTCCGATCACGTTGAGACGGTACAGGTATTCGAGAGGCGTTTCGTCAGGTCGTTTCTTCGCGTGGTA
GTACTGTCGGCCCAACGATACTCCGTGTCCAGCGTACCCCATCAAGATATTATCCATCAGAGCCTTCCACTTGAATCGTGTCGATCTGCTCAGCTGACGA
TACCAGTAACGGGCCGGACCTACCAACAGGTCGCCAAAAACCAGACACTTATCTTCTTTTTGGTGCTTGATCTCGGAGGAATGCTGATTTAACCTTACCG
ATCCAACTTCAGGCTCGATCTTCATCCGGATCTTTGCCTGAGAATTCCTTCAACTCCGAGATCGCTGAGACTCTGATCCTCTGCGTGGTAACATTTTACT
TGTATCGCCGATCGTAGCCACTTGCAGTTTCCTTAGTTCCGGGATCCATAAATCGTCCGGGTCATATTCTGCTCTCTGCAGAAATGGCTCCGACACAACC
GATTCCATGTCTACATCTGGCACATCGCGACCTTCAGGCTGAGGCGGGGGAACTCTGCCTCGATCTATGTGCTGTTTCATCTCCTTATCCGCTTGCCGTT
CATCTAGGAATTTTTCCATTGCAGCGTTGAAAGTTTTGTCCAAAGCGTTCTGCTCATCCCTGTTTGATCTGGCCCTCGCCGGTGCACGCGGTGTTTGTAC
CTCGGTCTTGAGATACCCGTGTGTCGGCTCGATATTGACTCTGTCCATCCGATCTCTTAAGAAGGATCCTCTTAATGGTCCTCGAGAAATCCGTCGGATG
CTGATTGATTCTTCCGAGTCGATCTCAGAATACGCGGAAGCACCGCGACGAATCTGATTGAGGCTCTTGGGCCCTATCGTACGGTGGCGCGATCTTGGCT
TCGGGCGTGGATACCTTGCCTACGAGGGAAATTATAATCCTGAAAAATTCGTCCACAGCACTCTGGAATTGATTCATGGTGCATTTCATTAGATCTTTTG
CTTCAAACGCCCCTGGGCAAAACCCCGTTTCCCACAACATCCGTATGATCAGATTAACCACGTCAATCTGACCGGTTACCGGTCCTGGAATTGTGATCGG
TTTACCTAGTGATCCAATCGGCTTTGGTTACGGATCGTGAACACCGGGTCTGTTCTAGCAGCATCTTCAGCTGGCTGTAGTTGTAGTTCCATTCTACACT
ATCCCACCTTTTCCCCACTGTCTCGATCTTTTGGGCTGCGTCTGGTGCGGGTTCATACTTGACTTTTGGTACCGCGATCTCGGCCAGTTCGCGGTCGTAT
TCTTCTTTGACCACGCCTTTCGATCTGGGAGGTTTGTTGATACGCTGATCTCCGTCCTCCGATCCTGGTGCTTTCATTTTCGTTCCCGATCCCGCGGGTT
GCTTGGCTGTCTTCTTCATCTTAACTCCAGGTGATGTCTCAACGAAGGCATAGGGTTTGGCTTTCGCCATTGGATTTTCATCGATCAGATCGTTCTTTGC
AGAACGACCTGCGGTGGTCCCCGAAGGGACCTCGAGAGGGAGTTGAGGTTTTTCTTCCAGATCGATATCTCGATCTTCTTCTTTCAATCTCTTAACATTA
GAATCCCTCCCAAATTCTGACGATCTGGGAATCTTGTATTTCTACGTGTCTGCGCCGATCCCTCTGTCGCTGACACTTCAATCACAGTTTCTTGCTTGAT
CTTGACATCTTCGCCAGTGGACTCACGGTGAAATCCAAAGGCCTCAGAAGATCCGGGCACGCGCACCATTGCGGTGAGGTCGATCTTATAAAACTGCTGA
TGTGAGTGTCGATCTTCCACTTGCCCAGACTTGCCGACTTACGGAGGGGGTACTCTGATCCGTGCCTTGAAGTATAGTCTTGTGCTCACGTTGTGTACCC
GTTGGTTGGGCTGGATTGAGCTCTTCGTAACGGCCTTGGGAGATGTCGGTCTCGTTGTGAGTTCGGGATCGAGGTTTGACCACTGTGCAGAAAATCTTCA
CACAGCGATCGGGGTAGTCTTGCGTCAATGTTCTTGTTAGATCGGTCCGATCTAGTTTTGGGACCGGTCGATCACGCTGGAAATG