Description :
From Genome Similarity Track
Location :
Scaffold_178:9219- 13319
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_178-fgenesh-gene-0.9Lariat debranching enzyme B
Pytir_DAOMBR486maker-pir_contig_178-snap-gene-0.27Glucokinase

Sequence
4100 bases(100 bases per row)
ACATAAAGAGCGCAAAGACACACATACGCATACTCCTTGGCAAACGGGTCGTTCTCAATTACGATCGGGGCGTCCACACACACTGCGCACCCAGAAAACA
CATCGAACGGAGGAAGCACTTTAGTCACAATCATCGATCACTTCAGCCACAAATCGCAGCCACACACGCACCAAAGTCAACGCTGGACTTGAACGCTCTG
CGGAACGCGGCGATGCGGCCACGCAGCGTCTCGCTGTTCTGCGCGTAGCCGTGCAGGCAGAGCACGCGGAACTTGTCGGTGGAGCTCATATCGATTGATC
GCTTGTCAGTTTGTCTTCTTCACGTTCCGAGGTTGATTGCGTAGTGACCTCGGTTTCGATGCTTGTCATTGGTTCAGCTTTCAAAATTGGCTAGTGCCAC
CAGCAGATATTTTGTCTGTGGCCAATGGGTGACAATTCAAACCATTCCTTGTTATCCACAAAAATACAAATTCCCATACAAAAGCCCAGTCAAAATCTTG
TTATAAGCTTACATTGAGGAGAATTATAACAACTAGTAAAGTTGCTAAGAAAATACAGATTTTGTCAACAACAGACTTGACGCGCGTGATCCTAAAGTTG
GTGCAAAACTCAAAACGTTATCCGCCAAATGGAGTCGTGACCATGTGCGGCAGTTCCAAGAACGCCAAGAGAGCGTCTGTCTGTGGGCTTCCGAGGTGGA
ACTCTGCCGTGTCCGAGCTTTCTTCGCCCAAAGGTGGCGCTGTCACCACGAAATCCGTGATCCATTCGCCTCGCACTTTGTTGGAGGAGCCACTGACCAT
TTCTTCATCGAGTCGCCTCTCGACCCAATCGACGTCAATGTCCATCTTCTCAATCGGTAGAACGACTTCCGCTCTGCTGCGTGATGCCAAGTAGTGCGTG
GCTCGGAGGATCGCGAGCCACTCCACGTCCATCATCACTCGGAGGTCACTATTGTCGTCCTCGAGCGAGGCTTCAGTGGTTTCAGGTAGATCGAGTACTT
CGAGACATGCTTTTCCAGGAAGGCATTTGCTCAGTGCCAGAAAGCGAGTCTGCTCATTCATCTCCTCACCACTTCCTTCTGAATCAGTATTGTGCTCCAC
TTGCGCTTCAAACCGAACATGCATGTGGCCCGCGAGCCACTTGGCTGGTCGCAGTGCATCCAGCAACAGCTCACCTCCAGGGTTCCCAAACACGTTTGTA
TTGATGCTGTGCCGGAAGTCTGGACGCTGTGCCAGCAATGCACCAATGTCGCCATGATTCTCGATATGCGTCGGCCAATCGTGCGACATAAACGCATCCA
GACGGCGCTTGCTGGCGTTGCTACCATTGGTAGACTCAGAGCTTGGAGTCAGGTGCGAAAGCTGGTAGACTTCATATTCGCGCACGCAGTAGACGCTCTT
GATCGCGTCCTTGTTATACGGCGCTCGTTCAAAGCGCCCTTTGTGGTAGTGCTTCGCATGGTAGATCCCGGAAATGCCAGCAATCCGGACCCCACCGACG
TTGATCACGCCCGCAGCTCCCAAGTAGAAGATGTTAGGGGCGACCCAGCCGCCGTACTGGAGCTCCTGGAGGTAGTTCGACGCCTCGTGATTGCCGCCGA
CGAAAACTGTGAGCACCGAAGCCCGCTTCTCGCCGCGGTAGTACTCATGGAATGAGTTCATGTGGCGGTACCGTAGCGGGCAAGCCTTGCACTTGAGGTC
GTTCGAGTTGCGCAAACACTCAAAATCTCCACAACAGAGGATCAGTTTGATACGCTCGCTTGGCGTGTCAGCCTCGGCGTTCAGCTGGTCCACTTTCGCG
TAGATCGCGTCCAGCTCGCCGTGCGTGCAGCCAACGAGAGCGACTTTCATCGAGAGCCTTGGAATTTTGGGGACTTGGGGGGTTAACTGGGCCAGCTGTC
TGCCTGTCGTGCTTGAGAAGCGAATTGATGAATTGATCAGCTCTTGTCGCTTTGCCTTACTTTAAAAAATGTACCCACGTGCACAGACTGGAGGTTATTG
GTAAAGTGGCCCACCTTAACTTCCCCTGGCTCAGAAAAACGATTGGTGTGAATGAAGGTCAGCAAAAAAGCCAAGCTGGTGAAGATTCAGCATCAACGTT
GCAGCTTGGATCTCCTCCTGTCAGAAGACGCCACCTTCACAGACCAGCTTGGTAATCTACATAGCAATCCGAGCTTCATTCATTTGCTTTTTGTTCCTTC
CGTCACTTGCTCGCCACATTACAGCATGTACGCACGACACGATGCAGCGGCACCAATGATCCCCGAATCGTAACCTGCACTCGCAATCTCGATTTTCACC
TGCGTGTGTAGTCACGAAAATGAACAGCACGATAATTCAATAATAGCAAGAGGATGGTCGTCGGTTGGAGGCGCCTTGTGTAAGTAGCGTACCGGATTTG
GGAACTTGGACCACGAGTATTTGCTGTAGGCGCTCCGAACTTCCTGCAAGAAGACGTTGCCAGCCTCTGCCATCCCACCCGAGAGCACAATCATCTATGT
CCCATTTATTATCCCCAAGCACATAGTACAACTCTTCAATTAGTATCACAGTATTCCGTGTCAGTCCACTTCAAAGGATGCACGAGTTTTACCACCAGTA
CCTCTGGATCAAGCATTCGGCAGAACGTCACGCACGCAAAGCCCAAGTAGTCTGCTGCCTATTGTATCAGAACAAGATGTTCACAAAAAAATCAGTAACA
CACACCCGAGGTGACAAGCTCATTTCCGTTTGCACGGAAATGGTCGTCGCTCACCTCTGCAATGAGCCGAGTACACATCGGATCGCCCTCTGCTGCGAGC
TCAAAGATGAGCTTTGCTGTGATGCTCTCGAGAGGGTACGCTGCGAGCGTCGAGTCTGCACCAGCAGTCATATGCTCTTGCGCTTCGAGCACCAGCGCCC
CCGCAGAGCTGTACGCTTCGAGGCAGCCACGCTGCGTGCACCCACAGAGTCGACCATTGCGCTCCACGATCTACACAGAAATACATACATGCATACACAC
ATACGCGGGGAGAAAGAGAAAGCGGTGAGCTATCAAGATAGTGAAACGTGCGTAGCAAACGGGAGATAACACAACAGCACCATGTGTCCGCCTTCAATGG
CGTTCGTGCCGCCACGAACCAATCTCCCGTCGTTAATGATGCCAAAGCCTACGCCAGTTCCAAGCGCTGTACGAGCATTCAGACGCAAGGAAGATGTACC
AAGTGATAGGGTGTTAGCACGATAGCGCGACAATCTCAATTCGTAATGGCAGGTAAATGCTGCTTTCCATACTGAGCATGATGAAGTTCTTCACGTTCTG
CTTGGCGGTGCCGACCCACTGCTCCGCCAAGATCGCGGCGTCCGCGTCATTGCACACATGGACCTGTAAAACAGCAGCATCAGTACAGTTATACGTCTGA
ACGCCACTCACAGCGTATAACTATCTCGAACACACACCTGAACCCCGTCAAGGTGATTGACAAACAGTTGCTGCAGCGGCACGTCGCTCCACGATGGGAA
GTTGGACGCCGCGTGGATCACGCCACCCGCTCGCAGAATGCCCGGACATCCGACGCCGACAGCGAGCAGATCCTTTCGTGTAAGCTTGAGCTACACATAA
GCACGCAATGAGTTCACATGTATCCCAACGACAGCACTCTGCATAGGGACGCACCTCTTCGAGCGCCTGCTGCAGCAGTGTACACGCGAATCCAACGACG
CTCGCGGGCGCCTGTTCGCTCGCGAGGATCTGCTGTTGCTTCCTCGCGAGTACGCGGCCGTCGGCGTCCACCACGCCCACTTTCACGCTCGAGCCGCCGA
TGTCGATGCCAGCGATCAGCGCCATTATTGCTGTCTTCTTCTCGTTTTGTGCTGCTTGGTGCAACCAGATTGACGACTGGAGCGCTTAAGTTCGCACCAG
ATCCAGGATCTTCTTTTTCGACGTGAAATATGGGTTGAAGGCAAAACTTGGTTCGTACCCTCCCCTCTCGTAATGAACTCAGCGAAACATCGGCCAGATC
GCCTGACGAACATGAAGGTTCACTTCATTATTTAGAGATAAGGTAACATAATTGAAATTTATCCTCTGGTGTTTTTTGCTCAACGTCTGTATCAATTCGA