Description :
From Genome Similarity Track
Location :
Scaffold_15:92170- 95742
Sequence
3572 bases(100 bases per row)
CTCTTTTTTATTGATGAGTACACACAAACTCACTACAACTATTGAAATGTCTGCTCCGTTGTGCCGACAGTTTCTTCCTCTCAAAGGATTTCGTATTCTA
AAGTATACATTGAATGACAATCCAAGGTGCGAACTTTAAGCTTGCCTTACATGCACATCTGCCCGAAATTAACCATACATAATGAGCTCGTTGAAACCCG
GATCCTGCATATTACCCAAATTTTCAACAGTGAGTCGTTCAACTTCAAGACATATGGCAACGATACTGCTACAACCCGGCTGGATACGGTAAGTATGTGA
CATTGCCAAGCAAATCACCAACTTCAATGGTGGCCACAGAAAGAGTATCAGATCGCATCGGGCGCCCTGTCATGTCTGACTTGAACCAAATAAATGGTGG
TGCTATTTCATCGGTAGTCCAATCCAGTATTATTATTTCCTTGCCGCTTTTGCCGAAAATCGAATGCTGTTATCCTTCCATTTTACTCGTCCAAGTCAAT
CGCGGCGAACAATCCAGTCTGAATTTCCCCCAGGGAGGACGTGTATATGTTAAGTGCGGTGAATAAGGCATTTAAATCTCACTCAACATCGATAATTCAT
CGGTGGTGTCTCTGAAGACAATCGTGGACCGCCTTAGCGGTTATCGGGGAAATGCAAGAGGAGATGTCGGGATCCGGGATTGTTGATAGTGGGTGGAATC
CGACAAGGGTAGGAGTATGAAACCACTCACAGACCATGGCACAGGATTGGCTCTATCAGCAACGTGACGAGAAAAGTTTGAAGTAGCACAAATAGCAAAT
CTGAACTTGTTAACGTAAAACACGCATTGTGAAATATGATTTGCGTGATTCTTGCAGTTCTTATAGGGAGTTGATATATTCACACACCCTTTCCTTACAT
TCCCAACCTTTTTTTTGAAGCCGATATTAGAACCCTTAAATCTCATATAGTTTTTCTATAGGTTTATATTTAATTTCATAATTTATTATGTAACACGCAA
ATAAAAAGATTACGAAATTAAATACTTATAATAGTGTCCTCCATTTAGCCGGATATAGTTTATGCGCCAATACATAATGGGAGGCGTTAAGCATCCACCC
CCTCGCAACAACTATTCACCCCCTCACACTTACGATGCTCTGATTGGTCAATAAAAAGAAACGCATTGCACATTTAAATCCCGGTTGGTCAGACAAGGAA
TGAACGAACACCTTTCTCACCAACAGCAGGTACATACGAACACTCATCTTCCTCTTGCAACTATCCCTTTTCCCACAACTCCTGAAAAATGAACGCCCTT
ACGCCCCCATGACACAGGCACATGCTTATCTTGCTGAGACTTAAGCAAATTTTTAGACCCGTTCAATATCACAGGGTATGTTATTGTTACGAAGCGTACA
AAGAGGGTTGGCAGGAGGAAGGAAGGTCACGTCAAGGTAATATAGTATCAGTGCTCACAATTAAATGCGCCTGTTGTGCTCAGTGGCCAACGTGAGCCTT
CGAAAAAAATTTATAAAATAAAACAGTTATTCGGGCCAAGCCGGAGCAGCGATTGTGTAAAACAAATCGAGTTTTAAAACCCTTAAGGGAATAATGCTCA
GACGCACAAACTTAGCGAAAGGGCCGGAGGTTTAGTTTACCGTTCAACAATATTTCAGCAAGTGTTCGTTGCATTTCTTTTTTATCGACCAATCCGAGCA
TTGTAAGTGTGAGGGGATGGATAGTTATTCCGAGGGGGTAAATGTTAAACGCCTCCCTAAATAATAATCGATTAATTATGGTTCCGAATTTTTCAGACAC
ACGGTGCTGCTTTGTTGACACGTCATTCCTACATTTAAAGGATAGTCTGAAAAAGATGAGAGACTGATAGCATACCATTTACGCGGTTGCATCTTACGAT
CTGCCTACATTTTAAATAGTGCTTCCGCCCACTAAAAGAGCGCGCAACCATCGAAAATACGCAATGAGCTTTTGTTATTATATGCGAACACCTGCACCTT
TCTTAAATCGTGTAACCAGTTGTCAAAATGGATCCCTTTCGTAAGATTGTTCCGCGGCCCTACTGTGAGAGTTTGTCCAAGCAGATCACAATGACGTACT
AATGCGTAATGAGTGTAGCAATGACTTTGCAGCTAATTTGTGCATCTGAATCTAAAATTCCGATATTTTGCTCACATTTTAGTCCAGACTGCGTGGTGGT
TGCGAAGGAGTACCGGAAGGACATCATATGAGGCCGAAAGGAGTGTTCATAACAGTTCTGGTGAAAGGATTTGTCTATTATTATGGTACCGAAGATAAAA
ATGTAGAATAAATGTGTATGGTATGTACTATATCAATTCTTAGACTGCATAGGGATGATTTTGATAATGACGTCGTTTTACCTACCAATGATCGCCCCTT
CCACTAGTACACGAATACTCCAAGATACACTCCTGAATAGTTCTTTTCATTGTATCGTAGCTTTAATTACAAGATATATATCATGTGGCCCATGAAGGTG
CACTCCTGTCAAGCGAATATATTTGTGAAGGTACAAATATAATGTAATATTCTTTCGATTGTTTTAGGTAGAGAAAGAATACGAGGAAATGGGGTATAAT
AACTGGTTTGGCAAAAGAAGGCGAATATCTGGTTTGACAGGAAGGGTATGAATATCAGGTTTGATGAAGGGTGTGAATTTAAGGAAAAGGGGTGTGAATA
TATCAACTCCCTTATTATATGGGAAATGTTAAACGTACCGGTCGCGAGTGGGTTATTGTACCGGCAGTTTGTTTTGGCCAATCAAAACACGACTTGGGAA
TCATAATCTGTTACACCAAATTTAGTTCCGACGATACCATCCTAATTTTGAGATACCTACCCTTCATCTTATTTTATTCGTATTTGCTGTAATGGCGATT
GATTGAAGGCGGAGAGCTACGAAGGCTATGGTAATGGAGGAGCCGCCGAGAAAATAGATTGGACACACTCGATAAGTTCCTATATATTTTGGCTCTATTG
ATGTATAGTGCTCTTACAGAGCACATTCCATGTTTAAGGCGTACATATGGATGCCAATTAGCATTTATGTCTGTCATTTGGCTTACTATTCAGGAAAATG
TCTGTGAGAGTCCACCGACATCGAACATTCATCTAAAAATGCCTGTTATTTGACATACCTCAATCCTGGTTGCCTTGAATCTGGCTGCTTTGACTGGTTT
GGCGTCGTTGTTGTTGTCGTGAACATCGTGAGTAATGTTTTCTCTGACAAAGCTGTTGTTGGACGCATCATTGTCAATCCGTGCTGTACTGGAACGTGTT
GCACGCACTTTGTGAACAGGCATCTCAATGGTGGTACTAGGAATGCTTTCACCATGATGCTGATATAGCTATTTCTGCTTAAAAGAGAAATGATAGTAAT
ATGGAATGTATATGGACGCAAGAAACAAGTGTAGTGTCTTAACTCACGAAGGTTAAATCATAAATAAGTCCACTTTATTTTGATTTTTTCGACGTATGCT
TGATCTCTATTCTATCTCAACCTTCGCGTTGTAGCTCATTGCCTTCCAGCAATCGCCCTTACAGTAACATCG