Description :
From Genome Similarity Track
Location :
Scaffold_151:9217- 12211
Transcript NameFunction/comments
Phyta_totarag4629hypothetical protein PHYSODRAFT_490809
Phyta_totarag4630hypothetical protein PHYSODRAFT_354436
Phyta_totarag4631hypothetical protein PHYSODRAFT_444636
Phyta_totarag4632hypothetical protein

Sequence
2994 bases(100 bases per row)
CAATGCGCCAAGCGGCTGCATTCACCGAACTGGGAGGTGCGAGCGGCGGCGTGCGACGCTCTAGCGGCGTTAGGCTTCGCGGACAAGGCGCGCaaggcgg
tggtggagcaCGGGGACGTGGTGCCCAGACTGTGCGCGCTGCTGACGGACCCGCAGTGGCAGGTGGCGTCTGCCAGTGCCGGGGCGCTCATGAGTCTGGC
GGCGCACGACGAGGTCAAGCGGCAGATCGTGGCCAACGAGGGGCTCGCGCCGGTAAATCAGCTGTTGCAGACCAAcaagacgccgctgcagtTGCATACG
ACCaagttggtggcggtggtcaCGGCGCTGCCAGCGGCGAGGCGGCTGCTGGACATGCCGGCCACGATACTGAGGCTGAAGACGCTCACGCAGGACGAGA
AcccgctgctggccaagagcgccaaggtggcgctggcggcggtgcagTGGCGGGCGTAGATAGCGGAGACGAACGGTAATGATGAAAGGCAGCTGACGTC
ACAGTTCAACAAACTGAGATGGATATGTTGTGTGGGGCACACCAATAGGAGGGATTGGGAGGGTTGACATCTGGATTGCATAATTTAATCAAGCCAACGA
CTTCTATATTTATGCGGACAACAGGGGGCGTGATTTTCTCCTGCCCTTCCCCACTCACCAAAACTCAGCTCAaggctcagcagctccagcttcagtGTCT
CCCCTCAGTCCATTAGTCAGCCATGGTGCGTGCGTCTACTGCTTCTGAGCCTCCTCTGCCCCCTTGCCCCCCTCCCACGTAATGCTGACGTCCGCCTTCT
TTCGtgctcctcctccccctTTCTCTTTCTTCCTATTGCAGTCTTCCGGTGTCGGTGTCGACGATGAGGTCATCACGCAGTTCAACGACTTCAAGCTGAA
GCGCGCCCCGCACGACTTCCGCTACTTCATCTACAAGATCGTGGATGACTCGGAGATCGTGATCGAGTCCACGGGCCCCAGCAGCGAGTCGTACCAAGAC
ATGGCCGACAAGCTGGCGCAGATCACGAACGACTGCCGATACGCCCTCGTGGACCTGGACCTGACCACCAAGGACGGCCGCCCCACCAGCAAGATCGTCT
TCCTCTCCTGGTACGTTTGTCAAACAGTCTGACTCTATCTATTCTACACAAAGAGTCTAATAATTGGGCTGCTCTGCTCCGTGTCCGCAGGTCGCCCGAC
ACGGCACGTAtcaagtcgaagatgctgTACGCGTCGTCCAAGGAGGCGATCAAGCGCGTCCTCATGGGCGTGGGAATTCACCTCACGGCCACTGATGCAT
CGGAGCTGTCGCTCGAGTCCATCGAGGACGGCGTGTCCAAGTTCCTGTAGACGAGTTGAACCAGTCAGTCGGATGCGTTTTGGTAGATTTGATTCGCCTC
TTCCCCCCGAAGGGATGCTCGAGTAATCCCAGGCATTTGCATTTCCTGCTCTTATCTTTTGTCCCTCTACGGCCGGCTACTTCTTCAACAGCTAAGGACA
ACACTTAGGTGATCCCATTGCAGCCATTGCAGCCAAGATACACAGCGCGATACTCTCCCTCACAACGTCACGATGTCGTCAGCTTGTAGCGATAGATCTG
CTACCGCTACAACccgatgtacatgtacccacTGTACGTGGCTTTTCACAGACCACCCAAATCATACACAAATTAGCTACCTGTCACACTCACGAGGGGG
TCTATTTCCGTCACAAAGAGAGGATTGCTCGCTTCACTCGCAATCGACATGGGATCGCGTCTTAGCGTCGTGCTCTGCTCGGCGGCTTGGCTCCCCTCAA
CCGCCTTCGCCGGGTCTGTGGACTCCCGCGACGTCGTATCTGCCTCGTCCGTCGCTCTGATCGTCGGCGtctgcctcgtcctcgccgcGAGCGCCTTCCT
CACGGTCGTGTACTTTCTCCCTCACTGGCTTCTGCGCTGCCTCGAGTGGAACTCGCACCCTTCCGTGCTCTGGAGCGTGCGCACCTCGTCCCGTGTGTGC
TCGCTGACTGTCGACGATGCGCCATCGCCTTCTACGCCCGCGATCCTCGACATCCTGCGCGAATACAAGGTCAAGGCCAcgttcttcatcatctcggGCC
ACATTCCAGGCAACGAGGAGGTGCTGCGACGAATCGTGCGGGAGGGACACACACTTGCCAACCACCTCACAGAGGACCGAGCCAGCATCCTGGACGAAAT
CCACGTGTTtgagcagaagctgcaggagtgCGACCGAGCCATCAGCGAATTCCAACCACCGGTGGACGAGCCGCTGGatacgcagcagctggtgcttGAG
GAGAAGGGGCCGGATGCTCTTCAGCCAGCAGCGGACGTTAATGACAAGACGaaagaagacgctgctcgACCTAGAGGCAAGTGGATGCGTCCGGCTTCTG
GCTGGTTCACGACACCCATGAGAGAAATCACAGCGCGTCATGGCTATCGCATCTGTATGGGAAGTGTGTACCCGCACGACGCGCAGATCCGATCCGAGAC
GATGAATTCGATGCATTTGCAAACACGCACGGGCTGCGGATCCGTGATTATTGTGCACGATCGATCGTGGACGATCGGTGTGTTGAGAACAGCGCTACCT
GTTCTCACACGCAAGTTTACGTTCGTGAGtctggacgagctcgtgTCGTACAATGAACAAAAGCCGAAAACAACGGAcgaagctacatgtagcaaatAAC
GCTGTATATTACTGCTTGGAAGGATGCTACAGTAGTTGTAAGCTATATAAACGCGTCGGGCAGAGTTTCGCGCTGCATCTCTAGTTCTGGCGTCGCTTCG
CTGGACTCGAGAGCTGCGCTGGTGCTTGTCAAGGAAAACTGCCTGTGCTGGGCTAGCATGAAGTTACGGAAAAGCTGCATAAGCAAGCACCCGTTAGATT
GAGGTTGCCGCTAGCTTGGATACAAACGGATATTAAATACAAGTATGGGCAGGCTTACCTCAGTGTGAAAGCACTGGCGGAAGAAATCGCGGCA