Description :
From Genome Similarity Track
Location :
Scaffold_442:9217- 10267
Transcript NameFunction/comments
Phyta_totarag8337hypothetical protein PHYSODRAFT_525670

Sequence
1050 bases(100 bases per row)
GTGGTGGCAGCTCGCATGGACGTTGATTGCCAAGTACAGCGACGGCTACATGACGACGGGTGAGGCTCCGGAGCAGCAGGCGTCAATCGGATACCCAGCT
TGGTGGCTGCAGGCCAGCGAATTCGCGACGTGGCCTGGTGACACGTTCAAGCCCAAGTCGAGCATGCGCAAGCAACTTTTGGGCGTCGACAGCGAGACCG
CACAAGGCTTCGTTCGCCAGGCAGCGAAGGCTGTTAATATCGAGGTGGAAGGACAAAGTTACCCGATCGCCATGGCCTGGGTTATCATGGGCGCTGTACT
GGGTGCCGCCATGCTCGCGTTCGCCAAGAAAGAGAGCCGCCGTGTCGGTTACCATGCGGTTGCGTAAGAACTCGCCTGCGTATTATTCATGGTGTACTCT
GAAGTACTAGAACACTGGTCACACGACTTTATGAACAGCACCGCGTTAACGGAAGGCATCAAAAGCAACAAGCTTTTGTGATGACAATAGACATTCTATC
TATCTCCAATCGTATCCATCCATCGTTTAGCTGGCTACCTCGGGAACTCACGTACCAAGAGTTAAGTCATACGCGGGCGGCTCGTAGGCGCGAGTACATC
GAGATGGCTCGAGTGCTCCGACGGCGATCGCCGTATTGACATCACTCAGAgacaataccggtactacatgtacaacgaTGACCAATAACATTGGCCTAGT
CGAAGTCGCCGTCGGCAACGTTGAAGTGATATGAGTTATCACACCGTCATGATCCCGAGAgatgtacagtacagtgcTTCCTCTCAGTAAGACTGCCGCT
GTACCGAGGAATCGGTCATTCTGGTGTTTATTGAGCAAGCATCTAATGCGTCGAAGCTCCATCAGCGCCAACTCGACTGCCACAATCGATGCTCCAGTAA
ACCTTTAACGAAATTAATTTTATGGTTCATACGTGCCAAGCGGCTCGCCTGGAGACTTTATCTTTTCATCTGGGAAGACAGACGGCACAAACAGCCATAC
GCGTCCACACCTACATGTAAGAGAGCAGAAAGCTATGGGAAGTAAAGCGG