Description :
From Genome Similarity Track
Location :
Scaffold_358:9216- 10277
Transcript NameFunction/comments
Phyag_g5005hypothetical protein PHYSODRAFT_355861

Sequence
1061 bases(100 bases per row)
TCTTTACGCCCAGGCGTCGAGGATCTCCTGGCGGGACTTCTTGaggtcctcgtcgtcgcggtCCTTGGCCTCGACAGAGATGCCCGGGAAGTTGTTCTCG
AAgatctccttgagcttgggcAGATCGGCCTTGGGCGGCGCGTAggtgccgctgttgttgtcgatcACCAGTTTGTACTTCCCGAAGTGGCCCTTCTCGA
TGTGGAACTCGCCCGCGTATTTGACGGAGAAGGCCGCGCTGGAGTGCAGCATGTGCTTGGACAACATAtccttgaagaaggcggcgccCGTCTCAGAGAA
ATACCATCCCGTGGGGGTGATGGCATAGGTAAAGAGCACGGGCTTGTCCAGGCGCTGGCCGTGGTTCACCAGCTTAAAGAAGTCAGAAGATTCATCCAAG
ACGCCGTACTGGGTAGTACTTCCATGTCTGTAGATCACTTCGTGCTCCGTGGCAATAGCCTTCCTCAGCACGGGAGACTCCGGGTGGTCCGGAGAGAAGA
TCTTCTGGATGGTCGGGTAGTTCTTGTTCCACTCGTGGTCTGTCGGCAGGATGTTCTGGATGTTGTGCAGTTGCACGTGGTAGGCCGAGGACTGgagctt
gtcgtcgtctgtcATGGAATGCGTCACCACGCCCGTGGCAAAGCTCAAGTGGCGAGAGTAGTGCACAGCTCCATACTGTTCCAGTTTCCCGTCCCCGTGC
GCTCTGGTCGCGTGGGACTTGACCTTCACTATGATAGTTCCGGCCGGCTTGCCATTGCGAGTGATGTTCAAGTCGAACGTCGTCTCAGTACCGTCCGTAT
TGGTGGCAGTGAATTGCGTGTCACCCAGCGCGTCATCGCCGTTcatgtcctcgtccagcaggtAGAGCTTGCAGACGGTGTTGGGCTTGACGTTCTTGAA
GTAGAACTTCTCGTTCCAGACGGGCTCCAGCGTGTCGAAGATGGGGCGTGTCCAGGCCACTTTCTTGCCGTCCACTTCGATCAGAGCGTaggcgtcgctg
gaggccACGTGGCCTTTGAGCGCCGCCTTCatgtcgaagaagtcgccGGCCGCGATGTCTT