Description :
From Genome Similarity Track
Location :
contig_20:9215- 10260
Sequence
1045 bases(100 bases per row)
TAGAGAAGATGGTGGTAGTCTCCACGTTGTAAATGCGTAGCAGCTTGGTATGTACAGACTTGAACTTGTGTCGAACAGCATCACGATACCAGGTTGATTA
AATGTCAAAGTAACATACTGCAAGTTACATTAAAAAAGACGGCTATCGGCTCTATGTCGGTGCGGAAGTGCTGGATTATCCAAGCCCATCACGGGATGCA
ACGTTTCGCCTCCAAAGTAAGACAAGCGGAATAAAAACCAAGTCTGGATTCTGTCAAGCGCTGTACAATGATTCATTGGTTGTTGTAGCAAAGAAGACGT
TGTCAAAAGCTTTATGTTGGTACGATAGTACCTTCCTTACACGGAACGTTATCACTACTTCCCAGAAACACATCACGATCTATCACAACTACTTACAAAC
GATCTGTTTGGTGGATAAACAGCTCTCCTCAATTCATTTTCTTACTTTGACTGACGGTTGTCCGACATCGATAGGCGAGGTTCCACCTACTTCACCACCC
TTAGCACCGTAATGCCAGTCGCTTGTACAGCGAGTAGCTCTCCCACTCGTCAAGCAGCAGCTCTATATCCACGAATTTGCCGAACCGGGCTTGTTGGATT
CATGAAGCGTTGCTGTGCGTGTGGTGCTGCGAGATCGCCAAGGCCTCCTGTACATCAACATCTCAAGCCCTTCGTACAGTTGCTATGTGCTGTAGCTCTT
GTCGAAGCTCCTGAGTTTCCACTCGTGCCCATTCTTGTATTTCGTTTCTAGCCACATCAGCTACTCGGGCTGCTATCGTTTGGGGGTTCGCTTTCCGAGC
CTTGACAATAGGGAGGTGCCCACGAGTCGGACCTCGAAGGCAGTCTACCAATCGGGTGCACAAGCGGGTATGGAAGGGTTGGTTCCACACGAATTCGGCA
AGCTGAGAAATGTGGTGGCACCTTAATTAACACAAAGTTAATAAACGAGACGTACTATATAACTTCTTGGGTCCAATAACCCGACAAGTGGTAGCAATCC
ATCCTCCATTTGACCATGCTTCCGAAGCGATATGAGGTTTAGGCG