Description :
From Genome Similarity Track
Location :
Scaffold_7:921497- 923321
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05313hypothetical protein

Sequence
1824 bases(100 bases per row)
TGAGTTCTCTCGTCCTCGAGTTGAGACTGTATCGCTGTTTGCTGCTGCGAGGTTGAAAAGCTCCTGTACCCAGTACGAAAAGAGATGGAAGTGGTTCATC
TCAAGCCGGTACTTAATAAGCAGCGCCAGAACCTCCTCAAAGTAAACCCACTTGAGTTCCGAAGTTGCAGACTTTTGGGACCATAGTTGCGATGATTTAC
GATTTTGACGACGTACTATCGGACTTCTTGGTGCCTGCACATTATGCTGCTTCGAATGAAACTGATTGTAGTTAGTTGATCGCACCATCGCACTGGCACG
GCGTGGTGATCCATCAGGACGTCGACACGAGTTTACAAATGTCGGACCGCCAGTTTCTTCTCCCTCTATTGTCGATGAGATTGCAGCCGCTTGACTGTCC
GGATCGACGAAGAAGGATGAGACGATAGACTCGAATTGGTGGTAACCATTGCTCGGCAGATACTGTCGATACACGACGTTCTCAATCTCAGTAAACGGCG
TGTCGTTTTCCACGATAAAACTCTCGTCTTCGACTCGGAAGAGTATTTTTGCGAGTTCAAGAACGTGGGGGATATCAATTATCTCGCGCATGGTAACAGG
ATGAAACATGGGGTGGCGGTGACACGACGAAGGCGCTGTGCCTGCTGGGCTTTCGTCGCTTGTTAACCGGTGTGCGCAGAGGTACCGACATATACAACAG
AAGATCAGTTCCTCTTCTGATCGCTCGTTCGTCATAAACTCCTGGAAGCGCTTAACATCCGGGTCGATCGCAGTAAAGTCCTCCATGGTTTCAAGAAGAT
TGGCCAACGCAGTATCAATAAGTTGCGATAGTCCTAAGCGACAGCGGAAATGCTCTCTAGCGAGCTGTTCAATGTTAAAATTGAGAGGAATGATCTGTCC
CGCAGGTGGATCAACAGCTACAGCTCTCGAGAAGAGCTGGGACCTCTGCTGACGCCACTCAATGAAGGATAATGTGAGATGGCAGCGAGAAGCAACAAGC
TCTGCTAGTTGTCGCGGTGGCAGCTCCTTGAGCTTCCCGACGATCGTGTCGTAGATGTCCGACATGAACTGCTTCAGAACTACCAGTCTTTTTCTCTGCT
CTCGCGATGCCAACACAGGCGCCAAGAGAAACTCGGTCTCTACCATATCTTGTCTGGAAGCAGGATAATACATGGCAGAGCTCCATAAACTGTCATCCAG
ATGCAGCTCTGCATAGTTTTGCAGTCGCATGGCTTCGCGTTCCCCGAACGGAATGTTGAGGGCATCGTCATCATCCAAAACGTTAGCATCAACCTTGGAG
TCGATATCTGTTTGCTGAGCCACATCGATATTGTCATTTTGGGTCTGATCCAGATCATCCAGTAGATCCGTTTGAGCCGCATCGTCACAATTCGCTTGTT
CGTTAGTGTCTTCCGGGGTCAGTTCACTGTCACTAACAGAGGCTTCCTCCTGGACCGTTCCTAGCACGATATGAAGCGAGCCTACAAGAGCTTGAGCCTC
CTGCATTGTTTGTTGGAAAAGCTCAACGTCTTCTTCATCCAGTGTTTCTGATGGAGCGGCACTAGCTGGTCTAGGAGGTAAGTCTCTCTGTTCCTCAATC
GACTCGTTCTCAGCAGTGAGAGTAGTGTCATTACTCTGATTATCTCTACGATGAAACATGGAAATGACAGACGCCAGCTCACGGAACGTTGTAAGCAGCC
GGATCAGCGTTTGCCTTGGATTTGGCTTTGTATCTACTTCAGCCTCTTGTTTACCTTCTTCCTCCTTGTTGACTTCTTCGTTGTTGTTCTCATTCGATAC
AGGTGTCTCCACTTCGGTGATCGG