Description :
From Genome Similarity Track
Location :
Scaffold_42:9213- 11889
Sequence
2676 bases(100 bases per row)
GTATGGCTTAAGCAAGCCAACGTAAATCACTGGGTGTGTGCGCAACTTGCGCAGAAGATTGAGTGTATAGACAAGGCCTTTCTTCGCTATGACCGTAAAC
GGCCCAATGAAGCGCGGACGCAATTTCGTCTTGAAGATGGTAGACACTACATTTGTAGGTAGGTTTTTAGCATTTAATAAGACTTGGTCTCCAACATCAT
AGAATCAATACATTCTCTGACGTTAGCATCAGATTTTTCTTTTTGGTTGTCTTGGCTATCAGCAATTGCATCACACACATGTTGTGAGACACTAAAACGC
GGTGCGAGAAAAACTCGCTCACTTGTTTCTGCATCGTGTTAGGGCTGATTTCAGCAATCTTTTCATCAGACTCTCCCCCACCAAGCCCAGAACCACGTAG
TGGTATCGTGAGCAGAACGCTGGGGTTCGTGAGGCTATTCACATATAAGGGAGTAAAGCCGGTCGAGGCATAAACAGCGTTATTCAACGCAAACTCAATG
ACGAGGAGCATCGATTTCCAAGTCTTAGGCGACTCAGCACAAACACTGCGAAGAACGTCGCCAATGATGCGGTTGACTCGCTCAGTCTGACCATCGGTCT
GCGGATGATCCACTGTGGACATTTCTAATCTCGTGCCGAGCACCTTGAAGATGTAATTCCAAAACTTGCCTGTGAGGCGAGGGTCGCGATCAGAGATGAT
TGTTAGCGGCAACCCGTGTTGACGAAACACACGATCAATAAACAGCATAGCTGTACCTTTGCCATCGATGGAATCCGGCACCGTCGCCAAGTGAGCCATC
TTTCTTAAACGGTCAACAGAGACCACAATTCCCTTATTGCCGTCACAGTCTTTGGGAAGACCAAACACAAAATTCATACTGATGGACTCCCAACACCCCG
TGGGCACAGATAAAATGGCGAGTGGCGCAGCCGAATGTGCTGAGGGTTTGATCCGCTGGCACGTTTCGTATGTACGCACGTATGTGCTCACCCATTTGTA
GAGTTTGGGCCACCAGTAGTGTTGACTCACAGAGCCATAAGTCTTTTCCCGGCCCAAATGCCCACTGAGGGCACTATCGTAGGCCCCAAAGAGGATTCGG
TTCCAAAAAACCTCATTGTGAGGCACAACAATGCGAGTGGTATCCGCTACATCTGTGCGATACCACAAAAGGCCATGATCGACGGAATATCGATGTAGAC
CGGCCAAGGCCGCAAGCGTGCTGGTGATTGACTGTCCTAGTCCTTGTATTCCTCACTCCCAAGGGCATGAAACTATGCCACACATTGAGGATCCCGTGGA
TACCACACGAATGAGCTCCTCAATAGCAGACGACAAAGTCGTGACATGAGCAAGCTCATAATCAGGTCTGCAAGAGAGGGCATCTGCCAACACATTTTGT
TTGCCTGGCTTATACCTCACCTCAAAGTTATATTCCGCAAAGAAGGAAAGCCACCTAGCCATCCTCTGAGAGAGGTGAGGCGACTGTGTCGCCGTGCGTA
ATGATGCATGATCCGTGTAGACGACTAATGGCTTGGAGCCAAGCAGGTGAGCTCGAAATATGACGCGCATACTTCATAGCAAGTAGCTCTTTGTCATGAA
CTGGATAGTTCTTTTCAGCATCTTTCAGCTGACGTGATTCAAATGCGATAACCTCTCGCGGCCTGCAGCATCTACTTGAAACATGGCACTGCCTATAGCA
AAATCGGATGCATCGCAGACAACACTAAAAGGGTACTCAGGATTTGGCAATGCCAAAATGGGAGCATAAAGGAGACTCTCCTTTATTGCCCGAAATGCGT
CAGCATGGGTGTTGTCCCAGCACCAACCTGTGTCCTTCTTAAGGAGATCATTTAATGGTCGAGCCATATCAGGGTAATTTTCACTGTATTTGTGTAAGTA
ATTGGCAAGGCCAAGCCACTTACGCAAGTCTTTTTGATTCTTAGGAATCGGCCAGTCCACTATAGCCTTGACCTTAGCGGGATCCGCTCTAAGGCCGCGC
TTACCAATGAAAAATCCTAGAAAAGGAATCTACTCTGCACCAAAAATGCATTTAGACGCGTTGGCGTACAATTTATTAGTGCGCATGCACTCGAGCACGG
CTCGCAAATGACCGATGTGATTTTCAACATCTGACCGACATTTTTCGGCACGACTATGGACAAAAGTGTCACAAAAGTACGTCTGTGCGTAATCCTTATG
TGGGCGGAAAAGTTGCGTCACCAGACGATTAAATGTTGCCGGATAGACAGCCCTTGGGGCATCACCAGCCATTCCCATAGCATACCACTCGGGGTTCTTA
CTGCTGTAAACGGAATATCACTCGCTCGCATGAGCAATTGATAATATGCATCGACCAAGTCGAGTGCACTATAAATAGTACAACCAACCATGTTGGTTTG
GAGAACATCCTTTCGAGGAATGGGTGTCTGTGCCGGAATAGTAGCCGCATTAAGCTTGTTATAAGTATGTACAATACGCCACTTGCCGTTTGGCTTTTTG
ACACAAAATGTCGGTGTCGAATGTGGAGATTTACTCTCACGTACCATTCCTGCCTCGTGCTTAGCACAGAAGAAGTCATCAATGACATCACATTGCTCCT
TAGGCAAGGTCCACTGTCGTGTGACACAGTATTTTGTCCCAGGAACTAAATCAATCTCATGACGGACACCTCTATC